Male/hermaphrodite line. Maintain at 15C to insure maintenance of male/hermaphrodite line.

Heterozygotes are WT and segregate WT, Sterile Dpys (Dpy is temperature sensitive), and dead eggs. ale-1 is a recessive embryonic lethal.

Animals with the Duplication are WT. Animals without the Duplication are Unc and Sterile.

Animals with the Duplications are WT. Animals which have lost the Duplication are Sterile and have an abnormal tail.

Pseudo WT.

Heterozygotes are Unc and segregate Uncs, dead eggs, and Pvul slow growing tm2610 homozygotes. Pick Unc to maintain and check for correct segregation of progeny. Reference: Bhalla N, et al. PLoS Genet. 2008 4(10) e1000235.

Unc.

Mechanosensory abnormal. Touch insensitive. Lethargic. Recessive. M-MATING++ 1-10%WT.

tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.

umnIs8 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.

umnIs18 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Dpy Unc, arrested hT1 homozygotes(GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.

umnIs28 [myo-2p::GFP + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.

umnIs38 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Homozygous-viable translocation marked with bli-4 and GFP. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.

Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs55 [myo-2p::mKate2 + NeoR, V:1005689 (intergenic)] III. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, Unc-36 mKate+(eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.

umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.

umnIs68 [myo-2p::GFP + NeoR, I:6284001(intergenic)] I. Break points: In(gsp-3 sre-23) I. Covered region (Mb) 3.5 (4.7..8.3). Derived by insertion of myo-2p::GFP transgene into parental strain FX19704 using CRISPR/Cas9.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

ju487 is a gain-of-function allele of syd-2, changing Arg184 to Cys. Reference: Dai Y, et al. Nat Neurosci. 2006 Dec;9(12):1479-87. doi: 10.1038/nn1808. PMID: 17115037.

Severe missense mutation. Bus (resistant to M. nematophilum), Bah (resistant to Yersinia biofilm formation), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1, drug and bleach sensitive. Slightly skiddy movement. Useful for drug screening. Reference: Xiong H, et al. Sci Rep. 2017 Aug 29;7(1):9839.

Dpy. Mechanosensory abnormal.

C-terminus of endogenous mig-17 locus tagged with mNeonGreen using CRISPR/Cas9. Reference: Fan J, et al. Elife. 2020 Apr 7;9:e55890. PMID: 32255430

Unc. Males are fertile.

Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::mCherry. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::Venus. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

tmIs1240 [myo-2p::Venus, X: F23D12.4] X. tmEx4950 [unc-9(+) + vha-6p::GFP]. Pick non-Unc with bright GFP+ in gut to maintain array. Balancer marked with myo-2p::Venus. Mec (Unc). Balancer break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

tmIs1233 [myo-2p::mCherry, X: F23D12.4] X. tmEx4950 [unc-9(+) + vha-6p::GFP]. Pick non-Unc with bright GFP+ in gut to maintain array. Balancer marked with myo-2p::mCherry. Mec (Unc). Balancer break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Larval lethal mutation balanced by tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)]. Balancer marked with myo-2p::Venus. Maintain by picking non-Unc GFP+ animals. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP mg663 homozygotes (lethal), and Unc GFP+ (homozygous tmC24). Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.

goeIs413 [hsp-16.2p::cnc-9::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-9::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

Cold sensitive Unc.

Cold sensitive Unc.

Cold sensitive Unc.

Partially resistant to 400ug/ml NaF. Weakly Dpy. (Not determined if this is due to ut5 or a closely linked mutation.) Suppressor of the slow-growing phenotype of mutations in flr-1, flr-3, and flr-4. gpla-1 formerly known as flr-2.

Short defecation cycle period. Semi-dominant.

Unc. Reference: Meelkop E., et al. Mol Cell Endocrinol. 2012 May 11.

lstEx24 [pdf-2p::pdf-2::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. lst24 rescues pdf-2; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.

Healthy and appears grossly WT. This allele is a 1563 bp deletion of sequences AATTGAGTAGACAAC....GTGTCTTAAATAT. Removes almost all of the 2nd RGS domain. Previously known as cec-9.

gc59 mutants are hypoxia-resistant. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.

Temperature sensitive, maintain at 15C. At 25C the embryos arrest at the lima bean stage. Will grow at 20C.

ts embryonic lethal. Grows at 15C. Does not grow reliably at 20C. Lethal at 25C.

Heterozygotes are WT and segregate WT, embryonic lethals (embryos fail to elongate) and Sterile Uncs. mc14 identified as a mutation that leads to abnormal lin-26 expression.

luc39 is a deletion of mir-791. mir-791(luc39) mutants show a decreased turning and reversal rate compared to N2 animals under conditions where the CO2 concentration is gradually increased from 0-5%. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.

luc30 removes mir-791/mir-790 binding sites in the unc-9 3'UTR. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.

Temperature-sensitive Lin.

Temperature sensitive Muv. Semi-dominant Dpy. Unc-moves backward better than forward; slight kinker in forward movement; larvae more severly Unc.

Wide, meandering excretory canals, with some septate fluid-filled cysts. Canal enlargement visible from L1 through adult. Defect visible only by Nomarski microscopy. n2669 was originally listed as an allele of exc-5. Later repeated complementation tests showed n2669 to be an allele of a novel locus positioned close to exc-5.

vlc19[ast-1::GFP] II. Superficially wild-type. Endogenous ast-1 locus tagged with GFP using Cas9-triggered homologous recombination. GFP was inserted at the C-terminus using a 9 amino acid flexible linker present in the plasmids (Dickinson et al., 2015). Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.