Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB969 C. elegans fat-2(ok873) IV. Show Description
W02A2.1. Homozygous. Outer Left Sequence: ATGTGATGTGATGCTGGGAA. Outer Right Sequence: TTGCTTTCTTTCGGCAAACT. Inner Left Sequence: CAATGCACCATATTTCACGC. Inner Right Sequence: ATCAGAAATTTGCCGGTTTG. Inner Primer WT PCR product: 2728. Deletion size: 1224 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB970 C. elegans ddr-1(ok874) X. Show Description
C25F6.4. Homozygous. Outer Left Sequence: CATAGCGACTGAAAAACGGG. Outer Right Sequence: GTTGAGCATGATGTGATGGC. Inner Left Sequence: TGGACGGAAACTTTGACACA. Inner Right Sequence: GGAATTCACCGTCCATGAGT. Inner Primer WT PCR product: 3323. Deletion size: 2974 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB971 C. elegans zipt-16(ok875). Show Description
T11F9.2. Homozygous. Outer Left Sequence: CTTCACAGCTCATCCACCAG. Outer Right Sequence: GAAACGGGCAATTCAAGTGT. Inner Left Sequence: GGCAACTACACAGAAGCCGT. Inner Right Sequence: TAACAAAGCAGGGATGGGAG. Inner Primer WT PCR Product: 2503. Deletion size: 595 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB972 C. elegans T01D3.5(ok876) V. Show Description
T01D3.5. Homozygous. Outer Left Sequence: GTGCTTGGCCAATTTTTCAT. Outer Right Sequence: CAGTTTTATCGGCGCTTCAT. Inner Left Sequence: TGAAACGCGGATAACATTGA. Inner Right Sequence: TCAGACAATGGAGGGGGTAA. Inner Primer WT PCR product: 2100. Deletion size: 1150 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB973 C. elegans Y76A2B.6(ok877) III. Show Description
Y76A2B.6. Homozygous. Outer Left Sequence: GGGGAAATGGTGTGAGTGAT. Outer Right Sequence: ACCGATTCTCTGCATTCACC. Inner Left Sequence: TTCGGAACATACGGAGGAAG. Inner Right Sequence: TGAAACCCCTGGAGAAAATG. Inner Primer WT PCR product: 3043. Deletion size: 2533 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB974 C. elegans gem-4(ok878) IV. Show Description
T12A7.1. Homozygous. Outer Left Sequence: TGAACGCTGACCTGAGTTTG. Outer Right Sequence: ATCATATTCGTCTGGCGGAG. Inner Left Sequence: GACGCGATTTGTAGCCTAGC. Inner Right Sequence: GTCTCTTTGCCATGGATCGT. Inner Primer WT PCR product: 3269. Deletion size: 1719 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB975 C. elegans T27F2.2(ok879). Show Description
T27F2.2. Homozygous. Outer Left Sequence: TTTTTCAGGCGTTCCATTTC. Outer Right Sequence: TTATCAGTGCGGATCAACCA. Inner Left Sequence: GCAAAATCGCAAACCTGAAT. Inner Right Sequence: CGACACACATTCGATATGGC. Inner Primer WT PCR Product: 2884. Deletion size: 2524 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB976 C. elegans rhgf-1(ok880) X. Show Description
F13E6.6. Homozygous. Outer Left Sequence: TTACTTTGGCCACACCATCA. Outer Right Sequence: GCATTCAAGTCAAAGGGCAT. Inner Left Sequence: CGTAGTTTGCGCACTCACAT. Inner Right Sequence: TGTAGGGATGCTATCTGGGG. Inner Primer WT PCR product: 3285. Deletion size: 1171 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB977 C. elegans lst-1(ok814) I. Show Description
T22A3.3. Homozygous. Outer Left Sequence: CGAAAGGGGAGTGGGTTACT. Outer Right Sequence: TTTGCACAGAATTCGCTCAC. Inner Left Sequence: ACATCTTAAAGGCGCACACC. Inner Right Sequence: CAGGAAAAAGAGGGAAAGGC. Inner Primer WT PCR product: 2631. Deletion size: 727 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB978 C. elegans F32F2.1(ok884) V. Show Description
F32F2.1. Homozygous. Outer Left Sequence: ATCTACCAACACTGGGACGC. Outer Right Sequence: TTTCCAATTGAACCCCGTAA. Inner Left Sequence: AGTTGCAGTTGCAGGTGTTG. Inner Right Sequence: GGTCCGAGAGCTAGTTGCAC. Inner Primer WT PCR product: 3161. Deletion size: 1337 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB979 C. elegans F28B3.1(ok885) I. Show Description
F28B3.1. Homozygous. Outer Left Sequence: TTCAAAATACCAAAAGCCGC. Outer Right Sequence: ATTGTTTCCACCGTTTTGGA. Inner Left Sequence: TTCTCATGTGCCCACACAAT. Inner Right Sequence: CAGTAATCCTCCTAGGCCCC. Inner Primer WT PCR product: 3046. Deletion size: 1112 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB980 C. elegans Y81G3A.3(ok886) II. Show Description
Y81G3A.3. Homozygous. Outer Left Sequence: TGTGGACCCGAAACAGTACA. Outer Right Sequence: AACACATCGGCTTCAATTCC. Inner Left Sequence: GGTTTCGGTGATGTCGTTCT. Inner Right Sequence: GTTTTCGGGATATTCGCAGA. Inner Primer WT PCR product: 2833. Deletion size: 1179 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB981 C. elegans F19F10.5(ok888) V. Show Description
F19F10.5. Homozygous. Outer Left Sequence: ACACCAGTTGCAATTCTCCC. Outer Right Sequence: AGTTTGGGTGAGAACCAACG. Inner Left Sequence: TTTCGCAGAATTTCGAGGAT. Inner Right Sequence: CTGTCGGCAAGAAGAAAAGG. Inner Primer WT PCR product: 2581. Deletion size: 2158 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB982 C. elegans flp-21(ok889) V. Show Description
C26F1.10. Homozygous. Outer Left Sequence: TCTGATGCGTTTACAGTCGG. Outer Right Sequence: TTTTCTTGTTCAACGGCCTC. Inner Left Sequence: TTAAGCGGAGCACACTTCCT. Inner Right Sequence: GGCAATTGAAAATTGTTGCC. Inner Primer WT PCR product: 3182. Deletion size: 1786 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB983 C. elegans ver-2(ok897) I. Show Description
T17A3.8. Homozygous. Outer Left Sequence: AAAAACTCGGCGTTTGTTTG. Outer Right Sequence: TTTAAACGTCTCCCGGTACG. Inner Left Sequence: TTTGTACAACTGGCTCAGCG. Inner Right Sequence: ACTCAGCCATCAGATCCCAG. Inner Primer WT PCR product: 3128. Deletion size: 1543 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB984 C. elegans sra-11(ok898) II. Show Description
F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CTTTGCTCCGCCTATTTGAG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: CACCAACCGGTCTCAATTTT. Inner Primer WT PCR product: 2100. Deletion size: 615 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB985 C. elegans sra-11(ok899) II. Show Description
F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CTTTGCTCCGCCTATTTGAG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: CACCAACCGGTCTCAATTTT. Inner Primer WT PCR product: 2100. Deletion size: 1004 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB986 C. elegans Y55F3AM.6(ok900) IV. Show Description
Y55F3AM.6. Homozygous. Outer Left Sequence: GTCGCATTTCCGTTCATTTT. Outer Right Sequence: ACGTCTCATTACGGGATTCG. Inner Left Sequence: AAATGCCACGTCATGAAACA. Inner Right Sequence: TTTGGGTCCAGAAAAGCAAG. Inner Primer WT PCR product: 2766. Deletion size: 1184 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB987 C. elegans sbt-1(ok901) V. Show Description
T03D8.3. Homozygous. Outer Left Sequence: TTCAGGCAAATCCATCATCA. Outer Right Sequence: GCCGTTGATAAAGGAGGTCA. Inner Left Sequence: TTTTGCCACCAATTCCATCT. Inner Right Sequence: AGTCGTTGCAGACGTCAATG. Inner Primer WT PCR Product: 2959. Deletion size: 1382 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB988 C. elegans cey-2(ok902) I. Show Description
F46F11.2. Homozygous. Outer Left Sequence: GAGGAAGCTCTCGAGCAGAA. Outer Right Sequence: GCAGACGCTATTGACGCATA. Inner Left Sequence: ACAGCGAAGAGAAGATGCGT. Inner Right Sequence: GGCTGAAACGTTCCTTTTTG. Inner Primer WT PCR Product: 2816. Deletion size: 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB989 C. elegans pros-1(ok903). Show Description
K12H4.1. Homozygous. Outer Left Sequence: TGACGAAATCAAAATGCCAA. Outer Right Sequence: AATGAGGAAGACGAGCTCCA. Inner Left Sequence: ATCCCGACAAAATCGAAAAA. Inner Right Sequence: GTCGGGAATCTGATCTTCCA. Inner Primer WT PCR Product: 2816. Deletion size: 1315 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB990 C. elegans F59G1.1a(ok911) II. Show Description
F59G1.1a. Homozygous. Outer Left Sequence: CAGAACGACTCGATCCACAA. Outer Right Sequence: AGCGGATAAAGTGCAGAACG. Inner Left Sequence: ATCCGATGGAAGTTGCAAAA. Inner Right Sequence: TACGCAGGCATCATGTTGTT. Inner Primer WT PCR product: 3116. Deletion size: 849 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB991 C. elegans C26H9A.2(ok912) IV. Show Description
C26H9A.2. Homozygous. Outer Left Sequence: ATGTCGAAAATGCCCAAAAC. Outer Right Sequence: AAGTCTGAACCAGGGGTGTG. Inner Left Sequence: CCCTGAGCGAGCACTTATTC. Inner Right Sequence: CGTGTTCAAAACTGCAAGGA. Inner Primer WT PCR Product: 2824. Deletion size: 1250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB992 C. elegans unc-104(ok913). Show Description
C52E12.2. Homozygous. Outer Left Sequence: AAGGTTTTGGAAAGATCGCA. Outer Right Sequence: CGACTTTCCTTGGAGCTCTG. Inner Left Sequence: CATTTGCTTCTTTTCCCTGC. Inner Right Sequence: GGCTCACATCTCCACAGTCA. Inner Primer WT PCR product: 3024. Deletion size: 1285 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB993 C. elegans tdc-1(ok914) II. Show Description
K01C8.3. Homozygous. Outer Left Sequence: AACGGTGCATTTTTCAGGAC. Outer Right Sequence: GGACGTTGAGAATGCGAAAT. Inner Left Sequence: AAATGGTTTACGGGCTTGG. Inner Right Sequence: ATGGTTGGCCATGTTGAGAT. Inner Primer WT PCR product: 2713. Deletion size: 629 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB994 C. elegans B0024.10(ok915) V. Show Description
B0024.10 Homozygous. Outer Left Sequence: TTGACGACGAACAGCTTGAC. Outer Right Sequence: TCAATCGAGCTTCACAGCAC. Inner Left Sequence: CATTTTGGCATAGCGGATTT. Inner Right Sequence: GTTTGTTGAAGCGAAGGAGC. Inner Primer WT PCR Product: 2517. Deletion size: 1140 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB995 C. elegans hpl-2(ok916) III. Show Description
K01G5.2a. Homozygous. Outer Left Sequence: TTCTATGCTCATCGTTCCCC. Outer Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Left Sequence: TTTTTACGGGCGAAATTCAG. Inner Right Sequence: TTCTGAGAATGCGTATTGCG. Inner Primer WT PCR product: 2399. Deletion size: 1739 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB996 C. elegans hpl-2(ok917) III. Show Description
K01G5.2a. Homozygous. Outer Left Sequence: TTCTATGCTCATCGTTCCCC. Outer Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Left Sequence: TTTTTACGGGCGAAATTCAG. Inner Right Sequence: TTCTGAGAATGCGTATTGCG. Inner Primer WT PCR product: 2399. Deletion size: 779 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB998 C. elegans php-3(ok919) III. Show Description
Y75B8A.1 Homozygous. Outer Left Sequence: TAATGGGACAGAAAGGCACC. Outer Right Sequence: CTACTTGCTCCTCCGTCGAG. Inner Left Sequence: TTGACGCGCAAAATATCTCA. Inner Right Sequence: CAATGCCACAGAGAAAAGCA. Inner Primer PCR Length: 2951. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB999 C. elegans Y73F8A.25(ok920) IV. Show Description
Y73F8A.25. Homozygous. Outer Left Sequence: AAAGTTGCAGTGGGGAAATG. Outer Right Sequence: AAGCGAATACGGATCATTGG. Inner Left Sequence: TTTCACGGAATTCTGGCTTC. Inner Right Sequence: TCTGAGCAAATTTTCCGCTT. Inner Primer WT PCR Product: 2305. Deletion size: 920 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RDV55 C. elegans rdvIs1 III. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
RDV83 C. elegans rdvIs1 III; zuIs45 V. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
RDV84 C. elegans rdvIs1 III; ddIs6 V. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. ddIs6 [pie-1p::GFP::tbg-1 + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
RE249 C. elegans qDf4/szT1 I; +/szT1 [lon-2(e678)] X. Show Description
Heterozygotes are WT. Segregates Lon males. Do not grow at 25C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RG3000 C. elegans sra-34(ve500[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3001 C. elegans sra-36(ve501[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acggcatttactcacagaaaatgggaatat ; Right flanking sequence: cgcttcaaagtttgtaatttgaaatttgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3002 C. elegans sra-1(ve502[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3003 C. elegans sra-3(ve503[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cagcgtgagaaaaatatcagaatgtgatcg ; Right flanking sequence: gtgggagattctatcaagagaattcactga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3004 C. elegans sra-4(ve504[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3005 C. elegans Y65B4BL.1(ve505[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
unc, dpy, rol, slight egl, pvl. Deletion of 1258 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tatccaatatcctacatcctatatcctcgt ; Right flanking sequence: attggaaaaatacgagacgatcgatgaaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3006 C. elegans sra-31(ve506[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3007 C. elegans sra-28(ve507[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 3237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aggaaaattaaatttcaattttcttgttcc ; Right flanking sequence: ggaggtgttagcttttaaaatatgactggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3008 C. elegans sra-29(ve508[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1279 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agtattcactctttgttgtctttaccgaca ; Right flanking sequence: GCAAAAGGTTTTTGGTACAAAATGGAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3009 C. elegans sra-20(ve509[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1413 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGTCGAAAGCTTAAGATGCGCTTCCGAAG ; Right flanking sequence: ctatcaatcctccttctttattttatcatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3010 C. elegans sra-18(ve510[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAATTGTGCTTCGGAAAGTCTCACCAATG ; Right flanking sequence: gtggggctcgacgtcaaggttttatttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3011 C. elegans sra-17(ve511[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3012 C. elegans sra-27(ve512[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3013 C. elegans sra-22(ve513[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1577 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaccgtcaacgctatcattaatttcatcc ; Right flanking sequence: gaaggcgaggcaagacgatttttctgtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3014 C. elegans sra-37(ve514[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2317 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaataaTTATACTGACGCGTATTTGCTG ; Right flanking sequence: CATtatggtctcatgaagtgctgctggaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3015 C. elegans sra-12(ve515[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTATTAGTGGAGCCAGAGAAACACAGGCA ; Right flanking sequence: CACGGGTACTTATTAATGGATAACACGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.