Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB815 C. elegans F18F11.3(ok628) IV. Show Description
F18F11.3 Homozygous. Outer Left Sequence: CTCACTCGGGAAAGCGTTAG. Outer Right Sequence: AAAGATTGGAGATGATGGCG. Inner Left Sequence: TTGCCACCGTTGAAACATAA. Inner Right Sequence: CACCAACCACTCCCCTTCTA. Inner Primer PCR Length: 3145. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB816 C. elegans sra-11(ok630) II. Show Description
F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CAGCTCATCCTGCTCAAATG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: GCGATTGTAGATGTCTGGCA. Inner primer WT PCR product: 2267. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB817 C. elegans abt-4(ok633) V. Show Description
Y39D8C.1. Homozygous. Outer Left Sequence: ATGGACAGCGTGTCATACCA. Outer Right Sequence: TTTGGGTAAGTTGGGCTTTG. Inner Left Sequence: CGGCTCCGTCACTTCTATTC. Inner Right Sequence: GATCTCAAGAACCCCGACAA. Inner primer WT PCR product: 3226. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB818 C. elegans hum-1(ok634) I. Show Description
F29D10.4. Homozygous. Outer Left Sequence: AGTGCATGCAAACAGCACTC. Outer Right Sequence: CAGTAAATACGCCGGTGGTT. Inner Left Sequence: CCAACCAGGGACTGAAGTGT. Inner Right Sequence: GTCAATGTTCAGCATGTCGG. Inner primer WT PCR product: 3054. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB819 C. elegans xbx-4(ok635) IV. Show Description
C23H5.3. Homozygous. Outer Left Sequence: TCAAACAAATTGCGAAGCAG. Outer Right Sequence: TGGGGTGCTGAAAATTTAGG. Inner Left Sequence: ATTCTGGGAGCCCAAGTTTT. Inner Right Sequence: GTGATGCTTCTCGGTCCAAT. Inner primer WT PCR product: 2596. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB820 C. elegans bmk-1(ok391) V. Show Description
F23B12.8 Homozygous. Outer Left Sequence: CGAGAACCTGCTTTTCAAGG. Outer Right Sequence: CAATCTTGTGCTACTGCCGA. Inner Left Sequence: ATTTGCTGCGAACCTTGACT. Inner Right Sequence: GCCGCGAATCATTGTATTTC. Inner Primer PCR Length: 2690. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB821 C. elegans clh-2(ok636) II. Show Description
B0491.8 Outer Left Sequence: AACAAATCTTCCCGTGCATC. Outer Right Sequence: ATCGATAGACCATTGGCTGG. Inner Left Sequence: GCTCAACTTCAGGGCAGACT. Inner Right Sequence: GTAGATATTGGCCATCGCGT. Inner Primer PCR Length: 2884. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB822 C. elegans dhs-6(ok637) II. Show Description
C17G10.8. Homozygous. Outer Left Sequence: CCATAGAGCGTTCACAGCAA. Outer Right Sequence: CTAACGTGTGGCTTTGGGAT. Inner Left Sequence: TATGTGCACCTTTACGGGGT. Inner Right Sequence: ACGCAATGCTGATGAAGTTG. Inner Primer WT PCR product: 3096. Deletion size: 924 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB823 C. elegans ceh-37(ok642) X. Show Description
C37E2.5. Homozygous. Outer Left Sequence: CACCCAACGGAACTCTTGT. Outer Right Sequence: GGTACACGAGCATGGGTCT. Inner Left Sequence: CGGAAATCGCAATGTAATC. Inner Right Sequence: TAAATTCGACTCGGGCTTT. Inner primer WT PCR product: 2900. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB824 C. elegans F52F12.6(ok646) I. Show Description
F52F12.6. Homozygous. Outer Left Sequence: ACGGATGGAACAGGTGACTC. Outer Right Sequence: TCATGATGGATTGGCTGAAA. Inner Left Sequence: TTGGGAAATTTGGAAACTGG. Inner Right Sequence: TATGAAACAAATGCTGGCGA. Inner primer WT PCR product: 3150. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB825 C. elegans hsp-43(ok647) X. Show Description
C14F11.5. Homozygous. Outer Left Sequence: ATTGCGACTTTCTGAGCGAT. Outer Right Sequence: CCATGTGATCACCCTATCCC. Inner Left Sequence: ATCATTTTTGACCAAAGGCG. Inner Right Sequence: GATCATCATCGTCCAACGTG. Inner primer WT PCR product: 2626. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB826 C. elegans F56D6.11&F56D6.21(ok650) IV. Show Description
F56D6.11&F56D6.21. Homozygous. Outer Left Sequence: TACGGGCCTCTGTCAATTTC. Outer Right Sequence: TCGTCGTGATTGTGTTGGTT. Inner Left Sequence: GCTCTCTTCCAAATGGCAAC. Inner Right Sequence: ATTCGGTGGCAAAAGTCAAG. Inner primer WT PCR product: 3169. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB827 C. elegans C23H5.8(ok651) IV. Show Description
C23H5.3, C23H5.8. Homozygous. Outer Left Sequence: TCAAACAAATTGCGAAGCAG. Outer Right Sequence: TGGGGTGCTGAAAATTTAGG. Inner Left Sequence: ATTCTGGGAGCCCAAGTTTT. Inner Right Sequence: GTGATGCTTCTCGGTCCAAT. Inner primer WT PCR product: 2595. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB828 C. elegans srd-2(ok652) II. Show Description
R05H5.1. Homozygous. Outer Left Sequence: AGCTCTCGTCATCGAGCATT. Outer Right Sequence: TTCGACATGCTCTCCAACAG. Inner Left Sequence: TTTGAATTTCTCACGGAACG. Inner Right Sequence: AGACGAACCCAAAATGATCG. Inner primer WT PCR product: 3326. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB829 C. elegans B0336.6(ok640) III. Show Description
B0336.6. Homozygous. Outer Left Sequence: GATACAATTCCCACGCCTTG. Outer Right Sequence: GGAAGGCGGAATGAGTGTTA. Inner Left Sequence: GCAGTGAGAGAACGAGCACA. Inner Right Sequence: CGAGTCATGCGAATCTTCAA. Inner primer WT PCR product: 2654. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB830 C. elegans epac-1(ok655) III. Show Description
T20G5.5. Homozygous. Outer Left Sequence: TGGCCACAGCTCTTTTCTTT. Outer Right Sequence: GGGAAAACTCACGGTTTTGA. Inner Left Sequence: GTGGAGGAAGACCGTGTTGT. Inner Right Sequence: TGCCACTGATGAAAGGAGTG. Inner Primer WT PCR product: 3313. Deletion size: 999 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB831 C. elegans tbx-8(ok656) III. Show Description
T07C4.2 Homozygous. Outer Left Sequence: CAGTTTTTGCCCGTTTTGAT. Outer Right Sequence: AGAAATTGCGTGGCCTAGAA. Inner Left Sequence: AAAATGTTCCCGAAGCTTGA. Inner Right Sequence: TCTTGGTGGCAGAAAGAACC. Inner Primer PCR Length: 2408. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB832 C. elegans F27E11.1(ok657) V. Show Description
F27E11.1. Homozygous. Outer Left Sequence: AAGGGATGCAGATGATGGAG. Outer Right Sequence: TGCAGGCCTTCAGAACTTTT. Inner Left Sequence: AACCGGGAAGGAGTTACGAT. Inner Right Sequence: TCATGGACTGTGGCAGTAGC. Inner primer WT PCR product: 2891. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB833 C. elegans T27D12.2(ok658) II. Show Description
T27D12.2. Homozygous. Outer Left Sequence: ATAAGGGCAATGAGCACAGG. Outer Right Sequence: TGAGCTCACGCCAGAATATG. Inner Left Sequence: CTCCAACCACGGCATAAAGT. Inner Right Sequence: TCTACGGCTTATAGCTCGGC. Inner primer WT PCR product: 3227. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB834 C. elegans amx-1(ok659) III. Show Description
R13G10.2. Homozygous. Outer Left Sequence: TCCCGAGTATTTCGGCTATG. Outer Right Sequence: TACGTAGCATCACCATCCGA. Inner Left Sequence: TGACAACCGATGCTTCTCTG. Inner Right Sequence: ATACCGACGAATCGATCAGC. Inner primer WT PCR product: 3023. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB835 C. elegans rcq-5(ok660) III. Show Description
E03A3.2. Homozygous. Outer Left Sequence: CACACGTTTTCGCATTTCAC. Outer Right Sequence: GGAGCGTACTTGCCACATTT. Inner Left Sequence: GCCAACTCTCCAGAAACCAA. Inner Right Sequence: TTTCAGAGATGAGCTCGGGT. Inner primer WT PCR product: 3002. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB836 C. elegans F57C7.2(ok661) X. Show Description
F57C7.2. Homozygous. Outer Left Sequence: ATCGCATGGACACCATCATA. Outer Right Sequence: TTGACTGGAAATGGAGGAGG. Inner Left Sequence: GGGCTTTCAAACATTACCGA. Inner Right Sequence: CGGTGTACAGCTTACTCGCA. Inner primer WT PCR product: 3059. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB837 C. elegans T07D3.4(ok664) II. Show Description
T07D3.4. Homozygous. Outer Left Sequence: ATGTCTAGGCGGTGGAGAGA. Outer Right Sequence: TGGGTGTTTGTGGTTGAAGA. Inner Left Sequence: GCAGTGTCGGCTGCTAATTT. Inner Right Sequence: TTTCTGAAACCCGTAGGACG. Inner primer WT PCR product: 2309. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB838 C. elegans T13H5.2(ok665) II. Show Description
T13H5.2. Homozygous. Outer Left Sequence: AGCTGGAAGAGGTTTGTGGA. Outer Right Sequence: CAACTTCAGGCTCCAGCTTC. Inner Left Sequence: TTTAGGTCCAGTGCTCGGTC. Inner Right Sequence: CCGAATTCGTTGATTCTGGT. Inner primer WT PCR product: 3051. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB839 C. elegans F54A3.4(ok666) II. Show Description
F54A3.4. Homozygous. Outer Left Sequence: ATAGAAAATGCGAGAGCGGA. Outer Right Sequence: GCCTGCCTACCATTAAAGCA. Inner Left Sequence: TGTGCAGGGTGTCTCATTGT. Inner Right Sequence: TTGAAATTTCTCGGGGTACG. Inner primer WT PCR product: 2859. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB840 C. elegans nhr-40(ok667) X. Show Description
T03G6.2 Homozygous. Outer Left Sequence: ATCAGTGTCCCCACCCATAA. Outer Right Sequence: GGCTTCCGTGTCTGAATGAT. Inner Left Sequence: TTCCATCTTTCTTCGTTCCG. Inner Right Sequence: TCGTCGACTTCTTTCCGTTT. Inner Primer PCR Length: 2895. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB841 C. elegans F14B8.1(ok668) X. Show Description
F14B8.1. Homozygous. Outer Left Sequence: TTCCATTGCTTCCCTCAATC. Outer Right Sequence: ATGGCAAGGGTGGTAGTGAC. Inner Left Sequence: ATTCCCAACATTTTCCACCA. Inner Right Sequence: TTGGCTGGGATGATTCTTTC. Inner primer WT PCR product: 2944. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB842 C. elegans abt-2(ok669) I. Show Description
F12B6.1. Homozygous. Outer Left Sequence: TGTCCTGGCCTAATTTTTGC. Outer Right Sequence: AAATGCCACGTATAATGCCC. Inner Left Sequence: GGCTCCACAGCAAATGAGAT. Inner Right Sequence: ACTGGAAATGGAACGAGACG. Inner Primer WT PCR Product: 2966. Deletion size: 1152 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB843 C. elegans wrt-5(ok670) IV. Show Description
W03D2.5, W03D2.3. Homozygous. Outer Left Sequence: GCGGTTTTTAATGGGGAAAT. Outer Right Sequence: TGAGAAGGAAGGATGATGGG. Inner Left Sequence: AACTGAGGCCTGGAGTTTGA. Inner Right Sequence: CAGCCTTTTTGGAGAGCTTG. Inner primer WT PCR product: 2763. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB844 C. elegans C06C6.5(ok671) V. Show Description
C06C6.5. Homozygous. Outer Left Sequence: TGAGGACACTCTCGCGTATG. Outer Right Sequence: CGCACACCTAACCATGACAC. Inner Left Sequence: AAATGTGAAATCTTTGCCGC. Inner Right Sequence: GTGCACCCGAGATCAAAAAG. Inner primer WT PCR product: 2464. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB845 C. elegans gur-4(ok672) II. Show Description
K09E4.5. Homozygous. Outer Left Sequence: TCGCGCAGTTATTTGAGTTG. Outer Right Sequence: TTCAATAATTCGGCTTTCGG. Inner Left Sequence: CGCCGAAACTTCTGAAAGTC. Inner Right Sequence: GTGTCTGAAATGGAGGGGAA. Inner primer WT PCR product: 3218. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB846 C. elegans F01D5.9(ok673) II. Show Description
F01D5.9. Homozygous. Outer Left Sequence: ATCATCAGTTTTCTTGGCGG. Outer Right Sequence: TTTTGCAGTGAGCGAAAATG. Inner Left Sequence: CTCTCCATTTCTCACCGCTC. Inner Right Sequence: TTCATGCGGAAATTGTTGAA. Inner primer WT PCR product: 2808. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB847 C. elegans C14H10.3(ok674) X. Show Description
C14H10.3. Homozygous. Outer Left Sequence: GCGAAAACTGAACACGGAAT. Outer Right Sequence: CCTTAACATGCGGCCATTAT. Inner Left Sequence: GAAAAGACGCACGAGGAAAG. Inner Right Sequence: ATTTCTGACGACTGGTTGGG. Inner primer WT PCR product: 3138. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB848 C. elegans rgef-1(ok675) V. Show Description
F25B3.3. Homozygous. Outer Left Sequence: TGTCGGCTTCTCTGTTGTTG. Outer Right Sequence: CGAGCGGTATCATTTTGGAT. Inner Left Sequence: CATACTGCCACGTGGTGAAG. Inner Right Sequence: GGAATTGCGAGCTATGGTGT. Inner primer WT PCR product: 2838. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB849 C. elegans kap-1(ok676) II. Show Description
F08F8.3. Homozygous. Outer Left Sequence: CATTTTGCTCGCTGTGAGAC. Outer Right Sequence: AACTTCTCGAACCACTGCGT. Inner Left Sequence: CCATGAATCCATGCCTCTTT. Inner Right Sequence: ATCATCAATTTGGCATGCTG. Inner primer WT PCR product: 3332. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB850 C. elegans egl-47(ok677) V. Show Description
C50H2.2. Homozygous. Outer Left Sequence: GATATGCTCATGTGGCATCG. Outer Right Sequence: AGATCGATGAGTGTGGAGGG. Inner Left Sequence: ATGCCATCTTTTTCAAACGG. Inner Right Sequence: GGAAGACCTGATTGGGTTGA. Inner Primer WT PCR Product: 2549. Deletion size: 966 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB851 C. elegans inx-20(ok681) I. Show Description
T23H4.1. Homozygous. Outer Left Sequence: GCAATCATGACAAAACGGTG. Outer Right Sequence: GGTCCCAACGGACACATTAC. Inner Left Sequence: GCCAACCTTGATTCCTCAAA. Inner Right Sequence: CCTGCTCAAACCACCTCATT. Inner primer WT PCR product: 2909. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB852 C. elegans ras-2(ok682) III. Show Description
F17C8.4. Homozygous. Outer Left Sequence: CTTCTCACATCAAACGGCAA. Outer Right Sequence: ACACCACTCATGCAAAGCTG. Inner Left Sequence: CCATGGATGCCTGAAAAGTT. Inner Right Sequence: CAGAAACGTTCGCAATTCAA. Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB853 C. elegans T14G12.4(ok683) X. Show Description
T14G12.4. Homozygous. Outer Left Sequence: AATAATCGACGTTTGACGGC. Outer Right Sequence: TAATCATCCTTGGAAACGCC. Inner Left Sequence: TTGGTGTTACAAGCACGGAA. Inner Right Sequence: ATCGCAGTGGTTAGTCCCAC. Inner primer WT PCR product: 2102. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB854 C. elegans lrg-1(ok684) III. Show Description
F55H2.4. Homozygous. Outer Left Sequence: TGATCCAATGAAAGGCAACA. Outer Right Sequence: TCTTGCAAAATGATCCCCTC. Inner Left Sequence: GCGGATATTTTTGGGAGTGA. Inner Right Sequence: CTGCTCTCGGATTTCGTAGG. Inner primer WT PCR product: 2912. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB855 C. elegans Y32F6B.3(ok685) V. Show Description
Y32F6B.3. Homozygous. Outer Left Sequence: CCCATTCTCGTCCACTTTGT. Outer Right Sequence: GTGATCCCATTCCAAAATGC. Inner Left Sequence: GAAGACAACGCCTCTGGAAG. Inner Right Sequence: AGGAAAATGGGTGAGCAATG. Inner primer WT PCR product: 2112. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB856 C. elegans B0393.5(ok686) III. Show Description
B0393.5. Homozygous. Outer Left Sequence:GTTCACCTGGATGGATTGGT. Outer Right Sequence:GCGAGTTCAAATTTTCGAGG . Inner Left Sequence: AAATTCAAAGGCAGCACCAC. Inner Right Sequence: TTCCGCAAAATCCAAAAATC. Inner primer WT PCR product: 3110. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB857 C. elegans pah-1(ok687) II. Show Description
K08F8.4. Homozygous. Outer Left Sequence:TCCAACGACGGTGAACACTA. Outer Right Sequence: CTCGTCACAAGGCAGTCGTA. Inner Left Sequence: CGTCTGTAAATCGAGCAGCA. Inner Right Sequence: GAAGTACGCCATGGAATCGT. Inner primer WT PCR product: 2344. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB858 C. elegans R09B3.3(ok688) I. Show Description
R09B3.3. Homozygous. Outer Left Sequence: CGTTGTTGATTTGTCCGATG. Outer Right Sequence: TGGTCTCCGCTCGTTCTACT. Inner Left Sequence: TGACGGTTTAATTTTTCCGC. Inner Right Sequence: CAGGATCTCAAGTGCCTCGT. Breaks are at R09B3 coordinates 4090/5259. Inner primer WT PCR product: 2206. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB859 C. elegans Y57A10C.6(ok693) II. Show Description
Y57A10C.6. Homozygous. Outer Left Sequence: AAGTTTGGTTGCCCAGTGAA. Outer Right Sequence: CCTGGCTACGTAGTTCCCAA. Inner Left Sequence: ACTTTTCCGATTTTCCGGTT. Inner Right Sequence: TCGTTGGAGTCGGTATGACA. Inner primer WT PCR product: 2202. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB860 C. elegans nck-1(ok694) X. Show Description
ZK470.5. Homozygous. Outer Left Sequence: TCTTGCCAGCCTTCATTCTT. Outer Right Sequence: TGTTGGATTTGTGCCTTCAA. Inner Left Sequence: TTCACCAACTTTGGCAACTG. Inner Right Sequence: GAACAATCAAGGGCTTAGCG. Inner primer WT PCR product: 2915. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB861 C. elegans F41D9.3(ok695) X. Show Description
F41D9.3. Homozygous. Outer Left Sequence: TGACACTGTTGCAGTCCTCC. Outer Right Sequence: ACAGAAGTCGTCGCTGTTGA. Inner Left Sequence: GCAGAAAGTGATCCGCATTT. Inner Right Sequence: TAACTACTCGTGCGCATTGG. Inner primer WT PCR product: 3367. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB862 C. elegans zig-2(ok696) X. Show Description
F42F12.2. Homozygous. Outer Left Sequence: TTTGTTTCGGGTAAAGCCAC. Outer Right Sequence: TTGCGCCCTCTAGAAACACT. Inner Left Sequence: TTTGTCTTGCCCCACCTAAC. Inner Right Sequence: AGCAAAGCAAAGGGCAACTA. Inner primer WT PCR product: 2229. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB863 C. elegans F22E12.2(ok697) V. Show Description
F22E12.2. Homozygous. Outer Left Sequence: TGTCGCCACGTAATCACATT. Outer Right Sequence: ATCCTCGTGCCACTCACTTT. Inner Left Sequence: ACACTTCTCCTCAACCCCCT. Inner Right Sequence: TGGCAACTTGCAAAATGTGT. Inner primer WT PCR product: 2460. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB864 C. elegans xpa-1(ok698) I. Show Description
K07G5.2. Homozygous. Outer Left Sequence: TGAGCGAGGAGAAAGAGAGC. Outer Right Sequence:AAAAACGACACGATAACGGC. Inner Left Sequence: AGATAGCCGGAATAGCTGGC. Inner Right Sequence: CTGGAGCCAATCCAACTGAT. Inner primer WT PCR product: 2133. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807