| RB765 |
C. elegans |
lite-1(ok530) X. Show Description
C14F11.3. Homozygous. Outer Left Sequence: CAAAGTCGCGAACAATTGAA. Outer Right Sequence: CGCTTGAGTGGGCTTTACTC. Inner Left Sequence: TGGCAAATTGCTTTGGGTAT. Inner Right Sequence: CAAGAAGACCATGATCGCAA. Inner primer WT PCR product: 3355. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB766 |
C. elegans |
icl-1(ok531) V. Show Description
C05E4.9. Homozygous. Outer Left Sequence: GTCAATAGTGCGACCGTCCT. Outer Right Sequence: CACAATGAGTTCTGCGGCTA. Inner Left Sequence: TCTGAGCCAAGAGTCGAGGT. Inner Right Sequence: GGTAGTCAAATCGGCTCCAA. Inner primer WT PCR product: 3099. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB767 |
C. elegans |
atgp-2(ok532) II. Show Description
C38C6.2. Homozygous. Outer Left Sequence: CCATCAACTAGTCGCCCAAT. Outer Right Sequence: ATGCCGCACCTATACCTTTG. Inner Left Sequence: TGATGTGAATCCTCCGTTCA. Inner Right Sequence: AGACAGTCAAAATGGACGCC. Inner primer WT PCR product: 3089. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB768 |
C. elegans |
C50F2.8(ok533) I. Show Description
C50F2.8. Homozygous. Outer Left Sequence: AGCGAAGAGTTTCCAACGAG. Outer Right Sequence: CAAACAAAGACGGGAAGGAA. Inner Left Sequence: ATTGATTGGAGTTGGCCTTG. Inner Right Sequence: CATCTCCAACCATGACACCA. Inner primer WT PCR product: 2778. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB769 |
C. elegans |
C17H12(ok548) IV. Show Description
C17H12. Homozygous. Outer Left Sequence: GAAATCCGCCTGAAAAATCA. Outer Right Sequence: GTGAAAACCAAGTGCAGGGT. Inner Left Sequence: AGCATTATCCCCGCATGTAG. Inner Right Sequence: AAACTGGGCGAGGGATTTAG. Inner primer WT PCR product: 2532. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB770 |
C. elegans |
Y18D10A.6(ok549) I. Show Description
Y18D10A.6. Homozygous. Outer Left Sequence: AAATGCAACAAGCCTCGAAC. Outer Right Sequence: ACCCACTTCTTCCACGTGTC. Inner Left Sequence: ATCCCTTGCAATTGTTGCTC. Inner Right Sequence: GTCGAGGGCTGACTTCTTTG. Inner primer WT PCR product: 3104. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB771 |
C. elegans |
hum-4(ok550) X. Show Description
F46C3.3. Homozygous. Outer Left Sequence: TCTGTACGTTGTGGAGGCTG. Outer Right Sequence: CTGCTTTGCATGTTCTTGGA. Inner Left Sequence: ACTTCCTTTGGCACAACTGG. Inner Right Sequence: ATCGAATTGAACGCTGCTCT. Inner primer WT PCR product: 2848. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB772 |
C. elegans |
atf-6(ok551) X. Show Description
F45E6.2. Homozygous. Outer Left Sequence: GGCGGGAGTTTAGGAGATTC. Outer Right Sequence: AAAGGCACGGAAATTGAGAA. Inner Left Sequence: AATGACCAGGAAATGTGGGA. Inner Right Sequence: AAGTGTCAATTGGCCAGTCC. Inner primer WT PCR product: 2983. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB773 |
C. elegans |
nud-1(ok552) III. Show Description
Upstream of the ORF of F53A2.4. Homozygous. Outer Left Sequence: ACCATTTCCTATTTTCCCCG. Outer Right Sequence: ATGGCTAACTTGGCATACGG. Inner Left Sequence: CCAGTTGTTCTCGGCTTCTC. Inner Right Sequence: GCACCATTGACATGTTTTCG. Inner primer WT PCR product: 1919. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB774 |
C. elegans |
zfp-1(ok554) III. Show Description
F54F2.2A. Homozygous. Outer Left Sequence: attcaatcagcctgtggagg. Outer Right Sequence: tgctgctgctttctcgttta. Inner Left Sequence: gttggcttgctgccaataat. Inner Right Sequence: cctacaagtggcatgcgata. Inner primer WT PCR product: 2733. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB775 |
C. elegans |
T28D9.3(ok555) II. Show Description
T28D9.3. Homozygous. Outer Left Sequence: CCACTCTGCTTGGTGTCTCA. Outer Right Sequence: GGTGATCTGGATCTGGAGGA. Inner Left Sequence: GTGCTCAATGCAGCAACAGT. Inner Right Sequence: CGTCTTCAGCATCACGAGAA. Inner primer WT PCR product: 2632. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB776 |
C. elegans |
kin-32(ok166) I. Show Description
C30F8.4a. Homozygous. Outer Left Sequence: gacaagtttgttctgtcccat. Outer Right Sequence: cgtcatgttcctatatgctca. Inner Left Sequence: tgtctgtcacgagcataaatc. Inner Right Sequence: ttcttggaatacggtccttgt. Inner primer WT PCR product: 3500. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB777 |
C. elegans |
hcf-1(ok559) IV. Show Description
C46A5.9. Homozygous. Outer Left Sequence: tcatttcttgcagcaattcgctgttaacactgcgagagcg. Outer Right Sequence: . Inner Left Sequence: attcgaatcgatgatggagc. Inner Right Sequence: aaattgaagttgcaaacccg. Inner primer WT PCR product: 2512. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB778 |
C. elegans |
F32E10.7(ok560) IV. Show Description
F32E10.7. Homozygous. Outer Left Sequence: CAGGAAACGTCTGTTCAGCA. Outer Right Sequence: CTCGTCTACAGTCGGAAGCC. Inner Left Sequence: TCTGCTCTTCCTCCAACACC. Inner Right Sequence: GTGGTCGATCAGGAATCGTT. Inner primer WT PCR product: 2879. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB779 |
C. elegans |
zig-8(ok561) III. Show Description
Y39E4B.8. Homozygous. Outer Left Sequence: aaaggttgagaacgccaaga. Outer Right Sequence: ctaggctgggctagggtagg. Inner Left Sequence: gcatcggagacagaaactcc. Inner Right Sequence: tctgtcttaggtgcctgcct. Inner primer WT PCR product: 2785. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB780 |
C. elegans |
tag-10(ok562) II. Show Description
C31C9.1a. Homozygous. Outer Left Sequence: AGGCCTTCAGCAAATCACAT. Outer Right Sequence: TCCCAATTTCCAGAATGAGC. Inner Left Sequence: ATCAATTCAACTCGTTCGCC. Inner Right Sequence: ATCGAGGTGACCGTGAAGAC. Inner primer WT PCR product: 2812. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB781 |
C. elegans |
pkc-1(ok563) V. Show Description
F57F5.5. Homozygous. Outer Left Sequence: AAATTGTGAAACCGCACACA. Outer Right Sequence: TTGCAGCTATCCTGAACACG. Inner Left Sequence: TTCGGTAAGCCAAGTTGGAG. Inner Right Sequence: GGCGAGCAGTAGCACACATA. Inner primer WT PCR product: 2594. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB782 |
C. elegans |
F27E5.1(ok564) II. Show Description
F27E5.1. Homozygous. Outer Left Sequence: CTGCCAGAGGTAAGTAGCCG. Outer Right Sequence: CAGATGGGAAGATCGGAAAA. Inner Left Sequence: TGAAAGACAACTTGCTCGGA. Inner Right Sequence: TGTCTTTTCAGCAGTCACCG. Inner primer WT PCR product: 3142. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB783 |
C. elegans |
scd-2(ok565) V. Show Description
T10H9.2. Homozygous. Outer Left Sequence: TGGTGGTGGTTCAAACTCAA. Outer Right Sequence: CGATGGCTAGAACACCCATT. Inner Left Sequence: ATCACAAACCAATTGGGGAA. Inner Right Sequence: GAGTCTGGCCGGTGTAGTGT. Inner primer WT PCR product: 3154. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB784 |
C. elegans |
F28H6.3(ok566) X. Show Description
F28H6.3. Homozygous. Outer Left Sequence: GGGTCCCCAGAGGTATTCAT. Outer Right Sequence: GAAAATGTTTCGGCTTCCAA. Inner Left Sequence: AGCACGAGAAGCTTTTTCCA. Inner Right Sequence: ACGAATTTTGCGAGACAACC. Inner primer WT PCR product: 2904. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB785 |
C. elegans |
dop-5(ok568) V. Show Description
T02E9.3. Homozygous. Outer Left Sequence: TTGAAACACGAGTGGGCATA. Outer Right Sequence: CTTCCACGCTTTCCTATTGC. Inner Left Sequence: AGCAGATCAGGAACGCAACT. Inner Right Sequence: TTGGTTTAATCGTCATGCCA. Inner primer WT PCR product: 2869. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB786 |
C. elegans |
stdh-1(ok569) V. Show Description
C06B3.4. Homozygous. Outer Left Sequence: GCTGGCATTGTTTCCAGAAT. Outer Right Sequence: GGCTACCACATTGTCCGAGT. Inner Left Sequence: AAGTGTCGAAACACGGGAGA. Inner Right Sequence: TAAAGATTGGCCCGCACTAC. Inner primer WT PCR product: 2645. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB787 |
C. elegans |
T27A8.2(ok570) X. Show Description
T27A8.2. Homozygous. Outer Left Sequence: ATCGAATACATCCGTCCAGC. Outer Right Sequence: TCTTGACCCAGAAACGAACC. Inner Left Sequence: GGCAACATACCATTTCCACC. Inner Right Sequence: TGACCCAGAAACGTACCCAT. Inner primer WT PCR product: 2645. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB788 |
C. elegans |
F11D5.3(ok574) X. Show Description
F11D5.3. Homozygous. Outer Left Sequence: GTTCAAAAAGAGCGCAAAGG. Outer Right Sequence: CAACCAATTCGGGAAAGAAA. Inner Left Sequence: TTTTCCTCGGCTACTGTGCT. Inner Right Sequence: GGACAATTTGAGCGGAGATG. Inner primer WT PCR product: 3007. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB789 |
C. elegans |
tre-2(ok575) IV. Show Description
T05A12.2. Homozygous. Outer Left Sequence: CGACTTGGAATAGTTGCCGT. Outer Right Sequence: ACCACCCTATGTTCTGTGCC. Inner Left Sequence: GTGAACCGCATGAAGAGACA. Inner Right Sequence: GTTTGGTGCGATGGAACTCT. Inner primer WT PCR product: 2568. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB790 |
C. elegans |
atf-4(ok576) X. Show Description
T04C10.4. Homozygous. Outer Left Sequence: TGTCGCCAGTGTTGGAATAA. Outer Right Sequence: ACCGTGAAGATGGAGGTGAC. Inner Left Sequence: CGTGCGCTTCAAGTTCACTA. Inner Right Sequence: GCCAGAAGGCTACTTGGTTG. Inner primer WT PCR product: 2701. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB791 |
C. elegans |
hsp-16.48(ok577) V. Show Description
T27E4.3, T27E4.8. Homozygous. Outer Left Sequence: TGGCATTCCTTCCTTATTGC. Outer Right Sequence: TGAGAAGCCGAGTAGCTGGT. Inner Left Sequence: GTAAGGCTTTCTGCCGTTTG. Inner Right Sequence: TGAGGGCCCTGTAGAAGTTG. Inner primer WT PCR product: 3051. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB792 |
C. elegans |
F09C12.2(ok582) II. Show Description
F09C12.2. Homozygous. Outer Left Sequence: ATGACCGTGGAGTGTGACAA. Outer Right Sequence: CGATCCCTCACTCGGATAAA. Inner Left Sequence: GGTTGCAGGGGTTCTGAATA. Inner Right Sequence: CTTGGCTCATTTTTGACGGT. Inner primer WT PCR product: 3078. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB793 |
C. elegans |
pbo-4(ok583) X. Show Description
K09C8.1. Homozygous. Outer Left Sequence: CGTTGGTAATGAGCACGATG. Outer Right Sequence: AGAACGAGTTGCGAATACGG. Inner Left Sequence: GTGTTGTGTCTTGGCATTGG. Inner Right Sequence: AAGGATGCCTTGTTGAGTGG. Inner primer WT PCR product: 2885. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB794 |
C. elegans |
nhr-41(ok584) IV. Show Description
Y77E11A.5. Homozygous. Outer Left Sequence: AGGCTCACCAAGAGCTTCAA. Outer Right Sequence:AGTAACCCGAGAATTTCGCA . Inner Left Sequence: TCAATTCGAAGCCCTTTCAC. Inner Right Sequence: CATTGATGAAACCTTCCCGT. Inner primer WT PCR product: 2853. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB795 |
C. elegans |
F28H6.3(ok585) X. Show Description
F28H6.3. Homozygous. Outer Left Sequence: GGGTCCCCAGAGGTATTCAT. Outer Right Sequence: GAAAATGTTTCGGCTTCCAA. Inner Left Sequence: AGCACGAGAAGCTTTTTCCA. Inner Right Sequence: ACGAATTTTGCGAGACAACC. Inner Primer WT PCR Product: 2904. Deletion size: 531 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB796 |
C. elegans |
sta-1(ok587) IV. Show Description
Y51H4A.17. Homozygous. Outer Left Sequence: AATTTCCAGACATGATGGGC. Outer Right Sequence: GCAATACGACTTGCCAGTGA. Inner Left Sequence: GCAGCCACACTTTATGAGCA. Inner Right Sequence: AAAGGTGCCAAATGAAATGG. Inner primer WT PCR product: 2902. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB797 |
C. elegans |
dsl-5(ok588) IV. Show Description
F58B3.8. Homozygous. Outer Left Sequence: ATTGGTGTCGCTTTCCTTTG. Outer Right Sequence: TGTACGGGTTCGAACATTCA. Inner Left Sequence: TCTGCATGTGGGAAGACGTA. Inner Right Sequence: GAGGCAATGGTCAGAGAAGC. Inner primer WT PCR product: 2708. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB798 |
C. elegans |
rrf-1(ok589) I. Show Description
F26A3.8. Homozygous. Outer Left Sequence: AGTCAGGAATTCGCTCAGGA. Outer Right Sequence: TCAATCATTGGCAGGTTTCA. Inner Left Sequence: GCTTGGCAATTCTTCTTTGC. Inner Right Sequence: TCGAAGGGATTCAATTCGTC. Inner primer WT PCR product: 3018. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB799 |
C. elegans |
C25G6.5(ok594) X. Show Description
C25G6.5. Homozygous. Outer Left Sequence: CAGGGTCTTAACACGGCAAT. Outer Right Sequence: TGCCTTCAATTTCATCTCCC. Inner Left Sequence: CAAAAATTGGAAGGTGAGCC. Inner Right Sequence: AAATGGGATCGGTGAATGAA. Inner primer WT PCR product: 2691. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB800 |
C. elegans |
hst-2(ok595) X. Show Description
C34F6.4. Homozygous. Outer Left Sequence: CCCTATCTACTGCCAGCGAG. Outer Right Sequence: GCGTCAGCAAAAAGAACACA. Inner Left Sequence: GAAATCGATGGAGGACGAGA. Inner Right Sequence: GCTGTGGAAAAAGCGAAAAG. Inner primer WT PCR product: 3131. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB801 |
C. elegans |
hum-2(ok596) V. Show Description
F36D4.3. Homozygous. Outer Left Sequence: AGCATCCAATATGGACGGAG. Outer Right Sequence: ACGTTTGGCAAGCCATTTAC. Inner Left Sequence: CGGATAAGGCTCGAAGATGA. Inner Right Sequence: ACGTCTCGCCAAATATCCAC. Inner primer WT PCR product: 2679. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB802 |
C. elegans |
srp-9(ok598) V. Show Description
F09C6.5. Homozygous. Outer Left Sequence: TTCACCATCGGTTACGACAA. Outer Right Sequence: ATTATGGACTTGCGAGGTGC. Inner Left Sequence: GACTCGAGGACAGGGATCAA. Inner Right Sequence: CACCTACCTCTACCGCCAAA. Inner primer WT PCR product: 2731. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB803 |
C. elegans |
ZK430.5(ok599) II. Show Description
ZK430.5. Homozygous. Outer Left Sequence: AGCCAATTATTCGGAAGCCT. Outer Right Sequence: GCCTCCTCACCTTGACTCAG. Inner Left Sequence: TGGCAGTATTTCTCGTGCAG. Inner Right Sequence: TCGAAGAATTCGGCTCAGTT. Inner primer WT PCR product: 3291. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB804 |
C. elegans |
T07F10.1(ok608) V. Show Description
T07F10.1. Homozygous. Outer Left Sequence: GGAAATCGATTGCATTCACC. Outer Right Sequence: TCAATTCGGTCAAAGGCTCT. Inner Left Sequence: TGAACCTGCATACAAAGCCA. Inner Right Sequence: TGTTTCCCTCCAAGTAACGG. Inner primer WT PCR product: 2758. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB805 |
C. elegans |
nxf-1&nxf-2(ok611) V. Show Description
C15H11.6. Homozygous. Outer Left Sequence: GCGGACGTACCATTCAAAGT. Outer Right Sequence: ACTGCAGCCTGAAAGTTCGT. Inner Left Sequence: GGCAGAAGTAAGGCTTGCAC. Inner Right Sequence: CATGGATTGACACACCTTGC. Inner primer WT PCR product: 3088. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB806 |
C. elegans |
tre-5(ok612) II. Show Description
C23H3.7. Homozygous. Outer Left Sequence: AAATGGCGATTCAAAGTTCG. Outer Right Sequence: TCTTTGCCACGTGACTGTTC. Inner Left Sequence: AACATCCGGGAAATCATCAA. Inner Right Sequence: CCCGTGGAATTTAAGACGAA. Inner primer WT PCR product: 2691. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB807 |
C. elegans |
vha-2(ok619) III. Show Description
R10E11.6. Homozygous. Outer Left Sequence: TTGAAACGCCGATATCATCA. Outer Right Sequence: AGCGATGTTGGAATAAACGC. Inner Left Sequence: CCCACATTCCAAATAAACCG. Inner Right Sequence: TTCGTAGTAGGCGCTGGATT. Inner primer WT PCR product: 2829. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB808 |
C. elegans |
D1022.3(ok620) II. Show Description
D1022.3, D1022.4. Homozygous. Outer Left Sequence: ACATGGCCGGTATTCTGGTA. Outer Right Sequence: TACGCAGACAACGTCAAACC. Inner Left Sequence: GGCGATGGACTACAACAGGT. Inner Right Sequence: CAGCTTTCCGAGGAATTACG. Inner primer WT PCR product: 2467. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB809 |
C. elegans |
ptl-1(ok621) III. Show Description
F42G9.9a. Homozygous. Outer Left Sequence: CCTCCTACCACCCATCTGAA. Outer Right Sequence: CAACATGCTCAGGGAAGTCA. Inner Left Sequence: TGAACCGAAGCCTAAACCAG. Inner Right Sequence: CTGGAAATTTGTTGGGCAGT. Inner primer WT PCR product: 2452. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB810 |
C. elegans |
R07E5.3(ok622) III. Show Description
R07E5.3, R07E5.14. Homozygous. Outer Left Sequence: ATTATTGTGATACCGGGCCA. Outer Right Sequence: AATTGAGAAGAGCGAGCGAG. Inner Left Sequence: CTACGCGAAACGGATCAAAT. Inner Right Sequence: CGTGGATTGGAGAGGACAAT. Inner primer WT PCR product: 2877. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB811 |
C. elegans |
glo-4(ok623) V. Show Description
F07C3.4. Homozygous. Outer Left Sequence: ATTCTGGTGGAGAACCAACG. Outer Right Sequence: AACAACTGCTTCCCGAGGTA. Inner Left Sequence: AGGAACATGACGAAAGGCAG. Inner Right Sequence: TGATTCCATCTGGCTCCTTC. Inner primer WT PCR product: 2769. glo-4(ok623) causes a a partially-penetrant Dpy phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB812 |
C. elegans |
fax-1(ok624) X. Show Description
F56E3.4. Homozygous. Outer Left Sequence: TAGTGCACGGACTAGGGCTT. Outer Right Sequence: AGATTGAGCACCACCAAACC. Inner Left Sequence: GGAAGCCCTAGCGAGAAGAT. Inner Right Sequence: CTTGAAGTGGCACGAGTCAA. Inner primer WT PCR product: 2430. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB813 |
C. elegans |
C41C4.1(ok625) II. Show Description
C41C4.1. Homozygous. Outer Left Sequence: CACCAGAAATTGAGCAAGCA. Outer Right Sequence: CCCTCGTCCATTTGCTACAT. Inner Left Sequence: TTGCATTTCGATTGGCATAA. Inner Right Sequence: CCCTGGTGATAACACGGTTT. Inner primer WT PCR product: 2704. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB814 |
C. elegans |
cdk-5(ok626) III. Show Description
T27E9.3, T27E9.4. Homozygous. Outer Left Sequence: GAAACTCAACTTCTTCGCCG. Outer Right Sequence: TCCGGTATACGCAAATGACA. Inner Left Sequence: ATGTCCGCTATGTTCAAGGG. Inner Right Sequence: TCATGTTGGCTTCCATCAAA. Inner primer WT PCR product: 2658. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|