Search Strains

Superficially wild-type.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad.

wgIs441 [Y53C12C.1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs522 [dsc-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs637 [dhhc-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

ubIs4 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains the complete hsp16.48-1 gene pair of locus hsp16A with lacZ cloned in-frame into the second exon of hsp16.1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn4.

Reduced survival after wounding. PHX1446 carries knockouts of 19 members of the nlp and cnc peptide families. sybDf1 is a deletion of a gene cassette including nlp-34, nlp-31, nlp-30, nlp-29, nlp-28, and nlp-27. sybDf2 is a deletion of a gene cassette including cnc-11, cnc-1, cnc-5, cnc-4, cnc-3, and cnc-2. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

Superficially wild-type. Deletion removes of wac-1.1/Y40B1A.1 and wac-1.2/Y40B1A.3 (I:13344075 to 13358647, version WS276, PRJNA13758).

Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.

Endogenous tdc-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc - recessive kinker. Daf-c at 25C. Egl, Clumpy, Lon, low brood size. Dauers do not recover when moved to 15C in the presence of food. Daf-c, Lon, Clumpy, and fertility defects can be rescued maternally.

Heterozygotes are WT and segregate WT, paralyzed Dpys, and Uncs which are sterile (with 1-2 escaper progeny). ptc-1 homozygotes have multinucleate germ cells (both sperm and oocytes). ptc-1 homozygotes have an underproliferated germline.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted at 3' end of endogenous src-1 locus using CRISPR/Cas9 engineering. gRNA sequence: AGCACAATTTTTTAGGCACT

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of M03C11.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCTTCAGCATTTTTCAGTCATACGGAGCATT. Right flanking sequence: GGGCGGGGAGCTTTTGGAAAAgttagttggttttttttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGTCATACGGAGCATTGGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

kfIs1[plc-1::GFP]. GFP is expressed in the adult hermaphrodite spermatheca.

kfEx2 [plc-1(+) + sur-5::GFP]. Pick GFP+ animals to maintain. plc-1(rx1) homozygotes are semi-Sterile. Animals with the array have normal brood size. Do not distribute this strain; other labs should request it from the CGC.

syIs373 [15xUAS::?pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)].  Histamine chloride channel cGAL.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs374 [15xUAS::(delta)pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)].  histamine chloride channel cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs371 [15xUAS::?pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)].  Histamine chloride channel cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cagTGGCAACCTACAACAAATTTCTCGCCGATCAA right flanking sequence: AAACGGCTTTGGGATGATTTATTCAAAGATTATGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATTTCTCGCCGATCAAAAA Method Reference: G3 (Bethesda).

cuc-1 null mutant. Grows well on standard media but has a slightly reduced brood size and ~10% of gonad arms show a migration defect. Reference: Zhang X, et al. Biometals. 2020 Jun;33(2-3):147-157. doi: 10.1007/s10534-020-00239-z. PMID: 32506305.

Vulvaless due to the lin-7 allele. Non-null allele of agl-1; Gro and Diet/nutrition-dependent maternal effect embryonic lethal due. Reference: Simske JS, et al. (1999). Ventral enclosure in C. elegans: getting to the molecules presented in International C. elegans Meeting.

Maintain at 15C.  Temperature-sensitive embryonic lethal with defects in embryonic cytokinesis.  Suppressor of the lin-2 Vul phenotype

Reduced brood size. cey-3(rrr11) was created using TALENs in the cey-2(ok902) mutant background to produce the double mutant. Reference: Arnold A, et al. Nucleic Acids Res. 2014 Dec 1;42(21):13353-69.

Slightly pale appearance. Reference: Arnold A, et al. Nucleic Acids Res. 2014 Dec 1;42(21):13353-69.

K07C11.5. Homozygous. Outer Left Sequence: GAACGGCCTATGGTGACACT. Outer Right Sequence: TGAGCAGAACGAAAGGAGGT. Inner Left Sequence: GACAATTGTTTTTGGACGGG. Inner Right Sequence: CCGAGCAAATTTGGAAACAT. Inner Primer WT PCR product: 2642. Deletion size: 1680 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15C11.2a. Homozygous. Outer Left Sequence: AGCTGCTCTTGAACGGTTGT. Outer Right Sequence: TGAATAAAAGGGGAACGTCG. Inner Left Sequence: CAGGAGCCCTTGCTCAATAG. Inner Right Sequence: GCTTATTAAAGGGGCCGAAG. Inner Primer WT PCR product: 2991. Deletion size: 1147 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1236.2. Homozygous. Outer Left Sequence: AATTGTAGAACCATGGCCGA. Outer Right Sequence: AACATGTGCAACAATTCCGA. Inner Left Sequence: CGTTCGGTTTGAGATGGATT. Inner Right Sequence: AGATGAGAGGCGCAGACATT. Inner Primer WT PCR Product: 2703. Deletion size: 2221 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.1 Homozygous. Outer Left Sequence: ttcaaatgcattgccaaaaa. Outer Right Sequence: ttggcaacaacaaagcagag. Inner Left Sequence: cctccgaattttcccatttt. Inner Right Sequence: aaagctgaaggatctgccaa. Inner Primer PCR Length: 2932. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C36A4.8 Homozygous. Outer Left Sequence: aagccaatgaactggtggtc. Outer Right Sequence: tttgtgtgcaaacaccgatt. Inner Left Sequence: gttgagaccgcagaaatcgt. Inner Right Sequence: caaaccgacacaaaatcacg. Inner Primer PCR Length: 2392. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54G4.8 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: ccgaagaattccgaatcaaa. Outer Right Sequence: tatcggcgcaagctactttt. Inner Left Sequence: tttggcgtcgaagaataacc. Inner Right Sequence: atgctgaggatcggattttg. Inner Primer PCR Length: 2598. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W09H1.6a Homozygous. Outer Left Sequence: tttcaggaaccaccgaaaag. Outer Right Sequence: gtagcaaacaaaatgcgggt. Inner Left Sequence: cgaagagccaaagtcctacg. Inner Right Sequence: ggagcatcgttgtttcgttt. Inner Primer PCR Length: 3198. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.3 Homozygous. Outer Left Sequence: aaaatcgaaccacggtcttg. Outer Right Sequence: tctctgcgacaaatgtctgg. Inner Left Sequence: agggcacggaaatgtgatag. Inner Right Sequence: tactccctgtgtccctttgc. Inner Primer PCR Length: 2921. Deletion size: 905 bp. Left flank: AGGGGAAAAAGGGAAAAAACGGCTGAAATT. Right flank: TTTTTCCATTTCTAAACTCGCGTAGTTGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.2, T26C11.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.4. Homozygous. Outer Left Sequence: CCAGACATTTGTCGCAGAGA. Outer Right Sequence: AATTCAAAGTTCCGCCAAGA. Inner Left Sequence: AGTATTGGCACGGACGAATC. Inner Right Sequence: CAGATGGACATCAGCCATTG. Inner Primer PCR Length: 3154 bp. Deletion Size: 870 bp. Deletion left flank: CATCGATGTTTGAGTGTTCTGAAAATGTGA. Deletion right flank: TCCTCCATTATAGCCGTCTGAATCCACATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07C11.1. Homozygous. Outer Left Sequence: GGAAAACATCGTGTGCCTTT. Outer Right Sequence: GTCTCAAGGCGAGAAGTTGG. Inner Left Sequence: ATTTGCGCGAATAACTGGTC. Inner Right Sequence: GCCAAAGCTTATCCCATTGA. Inner Primer PCR Length: 2358 bp. Deletion Size: 1165 bp. Deletion left flank: AACCAACAATCATATTCCCACCGGCTGGTT. Deletion right flank: AATGAATTAAATCAAATTTCTGGAAATCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35C11.1. Homozygous. Outer Left Sequence: AGATGCCGACGTCAATTTTC. Outer Right Sequence: ACTGTTGGGCCATACTCGAC. Inner Left Sequence: AATTCGGCTCAAAAAGCTCA. Inner Right Sequence: AGGGACCGAAGAGTGGATTT. Inner Primer PCR Length: 2278 bp. Deletion Size: 1477 bp. Deletion left flank: GCGTTCCAAATTTTATATCAACGGTTGATG. Deletion right flank: AAATTAATTTACCAGTTTATTGTATTGTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37B4.2. Homozygous. Outer Left Sequence: GGCCAACAATCACCAATTTT. Outer Right Sequence: CGCATCCCCTAATTGACTGT. Inner Left Sequence: GTACGGAGGTATTCCGACGA. Inner Right Sequence: GCCATCACGCTTTGAAAGTT. Inner Primer PCR Length: 2286 bp. Deletion Size: 2036 bp. Deletion left flank: TATCGAAAAGGTATGTGCTTTTAAGAGCGT. Deletion right flank: TGCCGTCAAATAGTGTTGTTCCATACAATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15C7.2 Homozygous. Outer Left Sequence: ttaaaaatgctgagggtggc. Outer Right Sequence: caatgggcaaagacgagaat. Inner Left Sequence: tggcaaatatcattgcagga. Inner Right Sequence: cggtgacgagagagtcacaa. Inner Primer PCR Length: 2903. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M7.2 Homozygous. Outer Left Sequence: aaatggcgccaagagatatg. Outer Right Sequence: tcacgcaattttgagttcgt. Inner Left Sequence: attgtcaggctgctggatct. Inner Right Sequence: cgattcaataattttcgggg. Inner Primer PCR Length: 2292. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E04F6.3, E04F6.6. Homozygous. Outer Left Sequence: AACGATGGAGAGGAAACGTG. Outer Right Sequence: TGAACCACGTCCAGAAGATG. Inner Left Sequence: GGACGGTCATTGTTATCTCTTG. Inner Right Sequence: CGGTGGGAATAAGACAGAGG. Inner Primer PCR Length: 3145 bp. Deletion Size: 2110 bp. Deletion left flank: ATACTTTTTTTGCAAATTATTTAAAACATC. Deletion right flank: AGTAAAACCATTCAAATATAATATAAATTC. Insertion Sequence: AGTAAAAACGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y92H12A.1 Homozygous. Outer Left Sequence: ctggcaccacgtgatatttg. Outer Right Sequence: tatccgctcacctctgcttt. Inner Left Sequence: catttacatggtggtgagcg. Inner Right Sequence: attcctcggcacataaccag. Inner Primer PCR Length: 2697. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48C11. Homozygous. Outer Left Sequence: ATACCCGCCATCATCTCAAA. Outer Right Sequence: TATTTCGGTATCTGCCGAGC. Inner Left Sequence: TCAGCAGCACTTGACAAACA. Inner Right Sequence: AAAATGTTCTTGACGCGGAG. Inner Primer PCR Length: 3211 bp. Deletion Size: 1618 bp. Deletion left flank: AACCCAAGTTGCTACAAATCATTTGAAACA. Deletion right flank: TGCTTACAATGAACAATTGTGTCCCGGATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3C.1. Homozygous. Outer Left Sequence: GGAATTGAGCATGTCAAGCA. Outer Right Sequence: GGGAATTCACCGAAAATCAA. Inner Left Sequence: TGCCGACATACAACAAGTTCA. Inner Right Sequence: CAAATCGGCAAATCGGTAAT. Inner Primer PCR Length: 1118 bp. Deletion Size: 373 bp. Deletion left flank: AACTCAATTCACAATACTCCTTTTAATTTC. Deletion right flank: ATGGCCACTGTGAGATTGGTACTAGTTAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17C11.2. Homozygous. Outer Left Sequence: ATGTGTGTGCTGCAAGAAGG. Outer Right Sequence: CGGAACGTCGCCTATAAAAA. Inner Left Sequence: GGTATTCAATCGCAGCGG. Inner Right Sequence: ATTCGGTTTGTCATCGCACT. Inner Primer PCR Length: 1325 bp. Deletion Size: 1048 bp. Deletion left flank: GACGTTGCTAACTGTGTTAATGCGTGTTTC. Deletion right flank: ATAATATTTCCTAAATTCTCTCATCTCAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14C11.3 Homozygous. Outer Left Sequence: acactcggttttcggctatg. Outer Right Sequence: tttcccaccaagcacctaac. Inner Left Sequence: atttccagaatccttgcgtg. Inner Right Sequence: agcgcatttttctgcatctc. Inner Primer PCR Length: 1120. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105C5B.21. Homozygous. Outer Left Sequence: ACATCTCACGGGTTCCACTC. Outer Right Sequence: TCGTAAGATTCAGCGCAATG. Inner Left Sequence: AAGTTCCCGATTCCTTGGAT. Inner Right Sequence: GCGTTCTACCAAAGCTACCG. Inner Primer PCR Length: 1249 bp. Deletion Size: 456 bp. Deletion left flank: CTCAAGGATCACAGGCTTCAACATATCCGC. Deletion right flank: AAACAAAGTTTTGAGCTTTTAACGTAAGTT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3C.1 Homozygous. Outer Left Sequence: ggaattgagcatgtcaagca. Outer Right Sequence: gggaattcaccgaaaatcaa. Inner Left Sequence: tgccgacatacaacaagttca. Inner Right Sequence: caaatcggcaaatcggtaat. Inner Primer PCR Length: 1117. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3C.1 Homozygous. Outer Left Sequence: ggaattgagcatgtcaagca. Outer Right Sequence: gggaattcaccgaaaatcaa. Inner Left Sequence: tgccgacatacaacaagttca. Inner Right Sequence: caaatcggcaaatcggtaat. Inner Primer PCR Length: 1117. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M03C11.3 Homozygous. Outer Left Sequence: aggtgctgttgagtcctgct. Outer Right Sequence: ttctctcctcgtccacgact. Inner Left Sequence: aaattccacaaaatccgctg. Inner Right Sequence: ccgggaacatccaaactg. Inner Primer PCR Length: 1090. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807