More Fields
Strain Species Genotype
RB1404 C. elegans lec-1(ok1597) II. Show Description
W09H1.6a Homozygous. Outer Left Sequence: tttcaggaaccaccgaaaag. Outer Right Sequence: gtagcaaacaaaatgcgggt. Inner Left Sequence: cgaagagccaaagtcctacg. Inner Right Sequence: ggagcatcgttgtttcgttt. Inner Primer PCR Length: 3198. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2274 C. elegans clec-106&Y18D10A.23(ok3084) I. Show Description
Y18D10A.12, Y18D10A.23. Homozygous. Outer Left Sequence: ACCACGACTGGGAAGTTCAG. Outer Right Sequence: GCCTAACATCTGCCTTCTCG. Inner Left Sequence: ACTGGATTCTAGGCCCACG. Inner Right Sequence: GTTGCTCCATGCTACGTGAA. Inner Primer PCR Length: 1318 bp. Deletion Size: 719 bp. Deletion left flank: TTCTTCCGCCAACCCATACCTCGGCTGTTC. Deletion right flank: AATGCTCCGCAACAATGCAACGATCCACCC. Insertion Sequence: GCTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3129 C. elegans clec-178(ve629[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
homozygous viable. Deletion of 954 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacttacgcaataggtatattccctaaa ; Right flanking sequence: gtaggataggttttactgtcagaagcttcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC2345 C. elegans clec-106&Y18D10A.23(ok3090) I. Show Description
Y18D10A.12, Y18D10A.23. External left primer: ACCACGACTGGGAAGTTCAG. External right primer: GCCTAACATCTGCCTTCTCG. Internal left primer: ACTGGATTCTAGGCCCACG. Internal right primer: GTTGCTCCATGCTACGTGAA. Internal WT amplicon: 1318 bp. Deletion size: 724 bp. Deletion left flank: CCTCCGTTTTGGTTTATGATATCGCGGAAG. Deletion right flank: TGCTCTTGAACCCGTCTCTGAACCAATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2919 C. elegans clec-198(gk3149) IV; W03G11.3(gk1251) X. Show Description
C49C3.13, W03G11.3. The gk1251 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AATGGAAAACGTTTGAACTTTGTAG. External right primer: AATTCAATCCATCATTTTCTGTGTT. Internal left primer: CATTGCCAAAAGGTGTCATAAA. Internal right primer: CCATCTTGGTACGATGACTCAA. Internal WT amplicon: 2027 bp. Deletion size: 969 bp. Deletion left flank: TATGATACAATGACTAAATATCGTAATCAG. Deletion right flank: TCCCCAATGACAGAATATGCCAAACTTTGA. The gk3149 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3965 C. elegans clec-118(gk5049) C17C3.3(gk5048) II. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
VC4119 C. elegans clec-199(gk5198) IV. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5198 mutation is G->A, flanking sequences AATTAAAAAATGTTTAATACCACCTATTCA and ACAGCAAAAACTACAAAGTCCACGACAACC.
VC4809 C. elegans clec-199(gk5877[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 5972 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GTAGTTCCGTTCTGACAGTTCTTTGTTAAG. Right flanking sequence: TGGCGCAACGAGGAACTTGGAGACCTTATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.