Search Strains

T10B11.2 Homozygous. Outer Left Sequence: GGTTCGGCAAAGCACATAAT. Outer Right Sequence: TAACAACGGCATTGAATGGA. Inner Left Sequence: TCATTCCGACGGTACCATTT. Inner Right Sequence: TGAAGCTTGAAATGCAGTGG. Inner Primer PCR Length: 2465. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y75B8A.2 Homozygous. Outer Left Sequence: TGGTGCCAAAATGATAGCAA. Outer Right Sequence: TTTTCTCAGTGGGTCTCGCT. Inner Left Sequence: TTTTCGAGTTCGTTTTGGCT. Inner Right Sequence: CGATATCGAGATTAGCGGGA. Inner Primer PCR Length: 2924. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10C1.2b Homozygous. Outer Left Sequence: aaaaatgggcgtgttcagtc. Outer Right Sequence: aaccgtcgaccaattctgac. Inner Left Sequence: ccgaaggatgcagaaacatt. Inner Right Sequence: gtgggcggagtcaactaaag. Inner Primer PCR Length: 3015. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52B11.3 Homozygous. Outer Left Sequence: attttagcctgtgtgcgctt. Outer Right Sequence: atgagaaaaatttgcgagcg. Inner Left Sequence: cggaattcgcaatgtctttt. Inner Right Sequence: tactgaaaaaggcaggcagg. Inner Primer PCR Length: 3300. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10B5.4. Homozygous. Outer Left Sequence: ATGATGATGGGACGGAACAT. Outer Right Sequence: TTTTGACACACCACACGCTT. Inner Left Sequence: TGGGACAAGGAAAATCGAAC. Inner Right Sequence: CGGCTTGTTTCCAATCATTT. Inner Primer PCR Length: 2809 bp. Deletion Size: 1676 bp. Deletion left flank: AATTGCATTGAAACCTTTAAAAAGAGTTTC. Deletion right flank: ATGCTCACAGAAACCGATGAGTTATCAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F31E8.3, F31E8.5. Homozygous. Outer Left Sequence: GCACAAGTTGTTGGGGAAGT. Outer Right Sequence: TTTTTGTCTGGGGTTGGAAG. Inner Left Sequence: TCTTTCACGGGACCTTCATC. Inner Right Sequence: ATCGGAGAACACAAGTTGCC. Inner Primer PCR Length: 2481 bp. Deletion Size: 1702 bp. Deletion left flank: TAAAATATGTAAATTTGATCATCAAAAATT. Deletion right flank: TCAATCCTCCAACGGATTCACATGTCTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10C1.2. Homozygous. Outer Left Sequence: AATTAGCTTCCCCGCAATTT. Outer Right Sequence: GTTGTTGATGCCTCCTTGGT. Inner Left Sequence: CTTTAGTTGACTCCGCCCAC. Inner Right Sequence: GCAAATGCGAGAAACCCTTA. Inner Primer PCR Length: 2999 bp. Deletion Size: 2379 bp. Deletion left flank: CAATTTCTAAGTAAGTAGTGTCTTGATCTC. Deletion right flank: AGCTTTTTGGTTTTGAAATGTTGAAAATTT. Insertion Sequence: ATTTCTAAGTAAGTAGTGTCTTGATCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53H4.1. Homozygous. Outer Left Sequence: ACAACTGGGAGAAAACCGTG. Outer Right Sequence: AGGAAGGTGTCGAGTGGTTG. Inner Left Sequence: GGCTGGGGGATTCAAATTAT. Inner Right Sequence: GAAGACTGATCATCGGAGCG. Inner Primer PCR Length: 3043 bp. Deletion Size: 1620 bp. Deletion left flank: CATCCGTTTCTTGGCGGCCTTCTTCTCCAC. Deletion right flank: TCGAGCTTTCGGAAACCACTGGTTCAGCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W06B11.1. Homozygous. Outer Left Sequence: AAAACGATATTGGGCTGTGG. Outer Right Sequence: GCATCGGTTTTCAGTGGAAT. Inner Left Sequence: AGATTGCCTGGGTGAAATGT. Inner Right Sequence: AGCCTATGCACAGAGCTGGT. Inner Primer PCR Length: 3070 bp. Deletion Size: 1660 bp. Deletion left flank: TTTAAAATGTTTGTTTTTTTGTAAATTGAT. Deletion right flank: TTATTTCAGTCTTTGGATGCCAAATTATAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02B11.7. Homozygous. Outer Left Sequence: GGATCTACCATGAGCCAGGA. Outer Right Sequence: CGAAAATGAGAACGGAAAGC. Inner Left Sequence: TGTGCACCCGTAGACACATT. Inner Right Sequence: GACGGGTCGTACTTTTGGAA. Inner Primer PCR Length: 2939 bp. Deletion Size: 1989 bp. Deletion left flank: AATTCGTCCGCCCATGGTGTATACCATCAC. Deletion right flank: CATGTCCAATGCTGGTGGATTCTCGGTTAT. Insertion Sequence: TTCTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W06B11.4. Homozygous. Outer Left Sequence: TGAAGCTAATGCTGAACCGA. Outer Right Sequence: CAGTACAAACGGCTGCACAT. Inner Left Sequence: TTGTGGCCTAAAATGCAAAA. Inner Right Sequence: TCATGCTTGTTTTTCTACCGA. Inner Primer PCR Length: 1280 bp. Deletion Size: 487 bp. Deletion left flank: GTAGTTTTCTAAAATTTTATTGTTAACAGT. Deletion right flank: AGATAAGATGTTTTGCAGATACAGCGAGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55B11.1 Homozygous. Outer Left Sequence: acttgcgcacaaacattcag. Outer Right Sequence: ccaaaaagtcaatgcagggt. Inner Left Sequence: gcattgtttcatcgtttcca. Inner Right Sequence: cagtttcacgcaattgatttt. Inner Primer PCR Length: 1211. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48E1B.1 Homozygous. Outer Left Sequence: aaatttgggaaaagcccaat. Outer Right Sequence: cgggaatgttaggggaaaat. Inner Left Sequence: tgaatttccgtcatttgaagc. Inner Right Sequence: tcctttggaaaatttcgttaaaa. Inner Primer PCR Length: 1192. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs47 X. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

okIs57 X. Pharyngeal GFP element integrated near unc-3 Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 5479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve724 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gggattaaaatataaaaggtttcgttttct ; Right flanking sequence: atattcaaagaaatacactcaagaaactaa. sgRNA #1: atgaaaatgtgatgaaagga; sgRNA #2: tgttcattgtaaaaggatta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1530 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagaTCAAGTTTCACGGGCGATTTCCTTCA ; Right flanking sequence: cggaattagtcatgcaaaacacatgacatc. sgRNA #1: AATACTCGTTCACTTCAGCC; sgRNA #2: aagaaaaacgtatgtttatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Emb. Deletion of 1090 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead eggs (ve823 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TGATCTTTGACCATCTCTTCATTCTTGCCC ; Right flanking sequence: TCGTTCTCAATGATGGCGGGACTCGTGTTG. sgRNA #1: TCCGAAGACTTGAACCCCTG; sgRNA #2: AGAGGCGTAGTATGGATATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1273 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCCGATTTTCCACCACTTGAAATTGATCCT ; Right flanking sequence: ATTGGAAGATAGATATTTGAATTTGACAAG. C45B11.6 sgRNA A: TCAAGCTTCCAATAGTCATC; C45B11.6 sgRNA B: ATATCTTTCGAGCATCTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Maintain by picking wild-type GFP+ mKate2+. Deletion of 7456 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead embryos (ve939 homozygotes; embryonic lethal), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Left flanking Sequence: CCATCAGAATGGCCATTCTCTTCGCAGCCG; Right flanking sequence: ttgtaagatttgtacagatttttcgagctt. deb-1 sgRNA A: ACAGGAGAACGATATTGTGG; deb-1 sgRNA B: accatccataagtctcaagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 972 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTTTCTTCTCTAAAAATTAAACATTTT ; Right flanking sequence: GATGTGCTCTCTCTTTCTCATCACCACTCC. otub-1 sgRNA A: CTTACAGGTAACAGGAACTA; otub-1 sgRNA B: GGGAGAGAAGACAAGAGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

jsIs1 [(pSB120) snb-1::GFP + rol-6(su1006)]. Roller Unc.

Almost full suppression of all unc-17 mutant phenotypes; animals are superficially wild type in appearance, development, and behavior, and males mate well. For additional information, see descriptions of the RM908 unc-17(e245) IV and the RM3659 snb-1(e1563) V single mutant strains. Reference: Sandoval GM, et al. Nat Neurosci. 2006 May;9(5):599-601.

e1563 homozygotes are superficially wild-type in appearance, development, and behavior. e1563 is a strong, dominant suppressor of UNC-17 G347R mutations (including e245, e359, p300). Molecular details: e1563 corresponds to an I97D (att>>gat) missense mutation in the SNB-1 transmembrane domain. Reference: Sandoval GM, et al. Nat Neurosci. 2006 May;9(5):599-601.

Homozygous viable. sdhb-1(tr405) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

Homozygous viable. sdhb-1(tr406) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

Homozygous viable. sdhb-1(tr411) is a T779A (I260N) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

Homozygous viable. sdhb-1(tr414) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

Homozygous viable. sdhb-1(tr438) is a C436T (H146Y) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

Homozygous viable. sdhb-1(tr454) is a C434T (P145L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

Homozygous viable. sdhb-1(tr455) is a C436T (H146Y) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

Endogenous deb-1 locus tagged with mCherry. Bright red fluorescence in all muscles is visible by dissection fluorescence microscopy. Please contact Ryan Littlefield prior to publishing work with this strain.

Endogenous locus tagged with GFP using CRISPR/Cas9. Body muscles are visibly green by dissection fluorescence microscopy. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10190 [C08B11.3::H1-wCherry::let-858 3'UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10808 [nob-1::H1-wCherry + unc-119(+)].

stIs11363 [T01B11.2::H1-wCherry + unc-119(+)].

stIs11366 [T01B11.2::H1-wCherry + unc-119(+)].

stIs11809 [M03D4.4b.1::H1-wCherry + unc-119(+)].

stIs11966 [F44E2.7b.1::H1-wCherry + unc-119(+)].

nfyb-1(st12190[nfyb-1::TY1::EGFP::3xFLAG]) II.

Heterozygotes are WT and segregate WT, Uncs (unc-82 unc-24 homozygotes) and dead eggs (unc-44 deb-1 homozygotes).

Heterozygotes are WT and segregate WT, Uncs and Pats. Maintain by picking WT and checking for correct segregation of progeny. Received new stock from Waterston lab 5/98. st554 previously called pat-8.

The endogenous tbb-2 coding sequence was re-encoded with tbb-1 mimic sequence, expressing TBP-1 from the tbp-2 locus. Reference: Honda Y, et al. J Cell Sci. 2017 May 1;130(9):1652-1661. doi: 10.1242/jcs.200923. PMID: 28302908.

The endogenous tbb-1 coding sequence was re-encoded with tbb-2 mimic sequence, expressing TBP-2 from the tbp-1 locus. Reference: Honda Y, et al. J Cell Sci. 2017 May 1;130(9):1652-1661. doi: 10.1242/jcs.200923. PMID: 28302908.

GFP tag inserted into the endogenous tbb-1 locus. GFP signals are detected at the epidermis, germline, intestine, muscle, and neurons. Reference: Honda Y, et al. J. Cell. Sci. 2017 May 1;130(9):1652-1661. PMID: 28302908.

gaIs146 [(pPRSK9) myo-3p::FLAG::pab-1 + sur-5::GFP]. Slightly slower growth than WT.

gaIs148 [ges-1p::FLAG::pab-1 + sur-5::GFP].

gaIs153 [(pPRSK29) F25B3.3p::FLAG::pab-1 + sur-5::GFP]. Pan-neural expression of FLAG-tagged PAB-1. Detect PAB-1 using anti-FLAG M2 antibody from Sigma. No map data for integrated transgene.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10190 [C08B11.3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

GFP::3xFlag inserted into endogenous pab-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.