| NJ678 |
C. elegans |
ifc-2(rh247) X. Show Description
Homozygous viable, but poor growth and some mortality at lower osmolarity. Large fluid-filled cysts in excretory cell body and shortened canals, sometimes visible with dissecting microscope. Encodes intermediate filament protein. ifc-2 formerly known as exc-2. References: Buechner M, et al. Dev Biol. 1999 Oct 1;214(1):227-41. doi: 10.1006/dbio.1999.9398. PMID: 10491271. Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501.
|
|
| NJ824 |
C. elegans |
rhIs15. Show Description
rhIs15 [mig-15::GFP]. Superficially. GFP is brighter at 25C.
|
|
| NJ831 |
C. elegans |
exc-3(rh186) X. Show Description
Excretory canal defect. Hypomorphic allele. Canals are slightly shortened. Defect visible only by Nomarski microscopy.
|
|
| NJ833 |
C. elegans |
exc-6(rh103) III. Show Description
Excretory canal defect. Canal varies in length from no outgrowth to almost complete outgrowth. Frequent small vacuoles and extra branchings in the canal lumen visible only by Nomarski microscopy. Animals are somewhat pale.
|
|
| NJL4274 |
C. elegans |
xrep-4(nic1522) I. Show Description
xrep-4(nic1522) is an engineered nonsence mutation [E22STOP]. Reference: Jochim B, et al. PLoS Genet. 2025 Jul 7;21(7):e1011780. doi: 10.1371/journal.pgen.1011780. PMID: 40623109.
|
|
| NK2318 |
C. elegans |
dgn-1(qy18[dgn-1::mNG]) X. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2324 |
C. elegans |
ina-1(qy23[ina-1::mNG]) III. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2436 |
C. elegans |
pat-3(qy36[pat-3::mNG]) III. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2446 |
C. elegans |
lam-2(qy41[lam-2::mKate2]) X. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2479 |
C. elegans |
pat-2(qy49[pat-2::2xmNG]) III. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK248 |
C. elegans |
unc-119(ed4) III; qyIs10 IV. Show Description
qyIs10 [lam-1p::lam-1::GFP + unc-119(+)]. Reference: Ziel JW, et al. Nat Cell Biol. 2009 Feb;11(2):183-9.
|
|
| NK2503 |
C. elegans |
rap-3(qy57[rap-3::mNG]) IV. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2540 |
C. elegans |
fdgt-1(qy65[fgt-1::mNG +loxP]) II. Show Description
Superficially wild-type. mNG tag inserted into the endogenous fgt-1 locus. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2585 |
C. elegans |
emb-9(qy83[emb-9::mRuby2 + LoxP]) III. Show Description
mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2617 |
C. elegans |
qyIs23 II; IqIs80 IV. Show Description
qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. Utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2623 |
C. elegans |
ucr-2.1(qy92[ucr-2.1::mNG]) X. Show Description
mNeonGreen tag inserted into the endogenous ucr-2.1 locus (C-terminus tag). Insertion verified by PCR. Left flanking sequence: 5' TCAGAAGGAACGACTCGTTG 3' ; Right flanking sequence: 5' CGAAAGTAGAATGCTAGTCAAG 3'. sgRNA: 5' TTTATAGCTCGTCGAGATAT 3'. Superficially wild-type.
|
|
| NK2629 |
C. elegans |
fdgt-1(tm3165) qyIs23 II; qyIs10 IV. Show Description
qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. qyIs10 [lam-1p::lam-1::GFP + unc-119(+)] IV. fdgt-1 formerly known as fgt-1. Reference: Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2631 |
C.elegans |
qySi99 I; unc-6(ev400) X. Show Description
qySi99 [lin-29p::fdgt-1::mNG + loxP] I. Unc. Single-copy insertion. unc-6 mutant expressing anchor cell specific fdgt-1 glucose transporter. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell 2022 March 21. https://doi.org/10.1016/j.devcel.2022.02.019
|
|
| NK2636 |
C. elegans |
fasn-1(qy98[fasn-1::mNG]) I. Show Description
fasn-1 locus endogenously tagged with mNG at the C-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2637 |
C. elegans |
unc-119(ed4) III; qyIs553 Show Description
qyIs553 [lin-29p::ceGreenGlifon4000 +unc-119(+)]. Superficially wild-type strain expressing green glucose biosensor in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2667 |
C. elegans |
F26E4.7(qy103[F26E4.7::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous F26E4.7 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2668 |
C. elegans |
C16E9.1(qy104[C16E9.1::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous C16E9.1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2669 |
C. elegans |
F26E4.3(qy105[F26E4.3::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous F26E4.3 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2672 |
C. elegans |
unc-40(qy68[unc-40::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous unc-40 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2673 |
C. elegans |
unc-5(qy70[unc-5::2xmNG + LoxP]) IV. Show Description
2x mNG tag inserted into the endogenous unc-5 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2688 |
C. elegans |
fbn-1(qy107[fbn-1::mNG (internal tag) + LoxP]) III. Show Description
mNG tag inserted into the endogenous fbn-1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2689 |
C. elegans |
lin-35(n745) I; qyIs23 II; IqIs80 IV. Show Description
qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. RNAi sensitized strain with utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2692 |
C. elegans |
test-1(qy108[test-1::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous test-1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2698 |
C. elegans |
sax-3(qy113[sax-3::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous sax-3 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2700 |
C. elegans |
eva-1(qy114[eva-1::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous eva-1 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2701 |
C. elegans |
nas-39(qy115[nas-39::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous nas-39 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2702 |
C. elegans |
C48E7.6(qy116[C48E7.6::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous C48E7.6 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2704 |
C. elegans |
cpi-2(qy117[cpi-2::mNG + LoxP]) V. Show Description
mNG tag inserted into the endogenous cpi-2 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2705 |
C. elegans |
col-99(qy118[col-99::mNG (internal tag) + LoxP]) IV. Show Description
mNG tag inserted into the endogenous col-99 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2706 |
C. elegans |
col-99(qy119[col-99::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous col-99 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2728 |
C. elegans |
cpi-1(qy127[cpi-1::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous nas-39 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2751 |
C. elegans |
T19D12.6(qy149[T19D12.6::mNG + LoxP]) II. Show Description
mNG tag inserted into the endogenous T19D12.6 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2764 |
C. elegans |
adm-4(qy153[adm-4::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous adm-4 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2779 |
C.elegans |
fdgt-1(tm3165) II; qyIs553. Show Description
qyIs553 [lin-29p::ceGreenGlifon4000 +unc-119(+)]. fdgt-1(tm3165) null mutant strain expressing green glucose biosensor in the anchor cell. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2783 |
C. elegans |
qySi567 I. Show Description
qySi567 [ced-10p::pyk-1a::mNG + loxP] I. Single-copy insertion. Glycolytic enzyme pyk-1a expressed under the ced-10 promoter which shows uterine expression and forms clusters only in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2784 |
C. elegans |
trak-1(qy158[trak-1::mNG + loxP]) I. Show Description
trak-1 locus endogenously tagged with mNG at the C-terminus. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2794 |
C.elegans |
fdgt-1(qy65[fdgt-1::mNG + loxP]) II; unc-6(ev400) X. Show Description
mNG tag inserted into the endogenous fdgt-1 locus. Unc. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2811 |
C. elegans |
F25H2.6(qy162[F25H2.6::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous F25H2.6 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2925 |
C. elegans |
sms-1(qy198[sms-1::mNG]) IV. Show Description
sms-1 locus endogenously tagged with mNG at the C-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2929 |
C. elegans |
fnta-1(qy199[fnta-1::mNG]) IV. Show Description
fnta-1 locus endogenously tagged with mNG at the C-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2935 |
C. elegans |
hmgr-1(qy202[mNG::hmgr-1]) III. Show Description
hmgr-1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2936 |
C. elegans |
unc-6(cp190[unc-6::mNG::3xFLAG + LoxP]) X. Show Description
mNG and 3xFlag tags inserted into the endogenous unc-6 locus. Superficially wild-type. Reference: Naegeli KM, et al. Dev Cell. 2017 Nov 20;43(4):403-417.e10. doi: 10.1016/j.devcel.2017.10.024. PMID: 29161591
|
|
| NK2943 |
C. elegans |
hmgr-1(qy202[mNG::hmgr-1]) III; unc-6(ev400) X. Show Description
hmgr-1 locus endogenously tagged with mNG at the N-terminus in unc-6 mutant background. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2966 |
C. elegans |
qySi205 I; unc-6(ev400) X. Show Description
qySi205 [lin-29p::icmt-1::mScarlet] I. unc-6 mutant expressing anchor cell specific prenylation enzyme icmt-1. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2984 |
C. elegans |
let-2(qy216[let-2::mRuby2]) X. Show Description
mRuby2 tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
