| NFB1139 |
C. elegans |
vlcEx641. Show Description
vlcEx641 [F37A8.5p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains F37A8.5 enhancer sequence (-2442, -1705) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB1149 |
C. elegans |
vlcEx651. Show Description
vlcEx651 [lgc-49p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains lgc-49 enhancer sequence (-2649, -1782) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB1151 |
C. elegans |
vlcEx653. Show Description
vlcEx653 [pde-3p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains pde-3 enhancer sequence (-2539, -1599) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB1164 |
C. elegans |
vlcEx666. Show Description
vlcEx666 [klp-7p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains klp-7 enhancer sequence (+1434, +2287) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB1171 |
C. elegans |
vlcEx673. Show Description
vlcEx673 [unc-32p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains unc-32 enhancer sequence (-1009, -76) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB1181 |
C. elegans |
vlcEx683. Show Description
vlcEx683 [mgl-2p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains mgl-2 enhancer sequence (-4183, -3367) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB1215 |
C. elegans |
vlcEx709. Show Description
vlcEx709 [mec-10p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains mec-10 enhancer sequence (-2831, -1860) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB1218 |
C. elegans |
vlcEx712. Show Description
vlcEx712 [npr-1p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains npr-1 enhancer sequence (-6888, -6130) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB1352 |
C. elegans |
vlcEx800. Show Description
vlcEx800 [pan-1p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains pan-1 enhancer sequence (-1050, -148) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB1369 |
C. elegans |
ast-1(vlc19[ast-1::GFP]) II. Show Description
vlc19[ast-1::GFP] II. Superficially wild-type. Endogenous ast-1 locus tagged with GFP using Cas9-triggered homologous recombination. GFP was inserted at the C-terminus using a 9 amino acid flexible linker present in the plasmids (Dickinson et al., 2015). Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB1692 |
C. elegans |
hlh-3(vlc28[hlh-3::mNeonGreen]) II. Show Description
vlc28[hlh-3::mNeonGreen] II. Superficially wild-type. Endogenous hlh-3 locus tagged with mNeonGreen using Cas9-triggered homologous recombination. mNeonGreen was inserted at the C-terminus using a 9 amino acid flexible linker present in the plasmids (Dickinson et al., 2015). Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB1719 |
C. elegans |
mod-5(vlc47[mod-5::T2A::mNeonGreen]) I. Show Description
mNeonGreen tag inserted into endogenous mod-5 locus. Upstream flanking sequence: AAATTATCGATAGTTCTCTTTTAGATCCAATcCAcACtCTcACaCCAGTT. Downstream flanking sequence: TAGATAATTCTTGGTGTACTGTTGGAAGTCAACGATCGATAGCCGTGCAC. Guide sequence: ACTGGAGTAAGTGTATGAAT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB1720 |
C. elegans |
tph-1(vlc46[tph-1::T2A::mNeonGreen]) II. Show Description
mNeonGreen tag inserted into endogenous tph-1 locus. Upstream flanking sequence: CTCTCCGCTCAGACATCAACCTGCTCGCCGGAGCTCTCCACTACATCCTG. Downstream flanking sequence: TAGTTTGAGTTTCCGTGTTTTTTATTTTTTTTATTTGGTTTCTGCTTTCT. Guide sequence: GTAGTTTGAGTTTCCGTGTT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB1722 |
C. elegans |
lag-1(vlc30[lag-1::T2A::mNG]) IV. Show Description
mNeonGreen tag inserted into endogenous lag-1 locus. Upstream flanking sequence: CCTACAAATCATTGGAACGACATGGACCGTGCAGAATTGTGTCCAATTAC. Downstream flanking sequence: TAGATTGGTCTCTCGCGGGATTACTGTATCTTTATATTGTCTCCTAATTT. Guide sequence: ATTACTAGATTCCACTCTCG. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB1895 |
C. elegans |
vlcEx1091. Show Description
vlcEx1091 [snt-1p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains snt-1 enhancer sequence (+993, +2170) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB1897 |
C. elegans |
vlcEx1092. Show Description
vlcEx1092 [sprr-1p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains sprr-1 enhancer sequence (-2810, -1905) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB1899 |
C. elegans |
vlcEx1093. Show Description
vlcEx1093 [sem-4p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains sem-4 enhancer sequence (+3376, +4551) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB1901 |
C. elegans |
vlcEx1094. Show Description
vlcEx1094 [C53B4.4p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains C53B4.4 enhancer sequence (-1590, -338) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NFB2057 |
C. elegans |
fkh-8(vlc43) II; otIs395. Show Description
otIs395 [ift-20p::NLS::tagRFP + pha-1(+)]. Ciliome defects. CRISPR-engineered fkh-8 null mutation. Reference: Brocal-Ruiz R, et al. Elife. 2023 Jul 14;12:e89702. doi: 10.7554/eLife.89702. PMID: 37449480.
|
|
| NFB2518 |
C. elegans |
dat-1(syb4741[dat-1::T2A::NeonGreen]) III; him-8(e1489) IV. Show Description
NeonGreen tag inserted into endogenous dat-1 locus by CRISPR/Cas9 engineering. NeonGreen expression in dopaminergic neurons. Superficially wild type. Reference: Jimeno-Martín A, et al. Genome Res. 2022 Mar;32(3):459-473. PMID: 35074859.
|
|
| NFB608 |
C. elegans |
vlcEx324. Show Description
vlcEx324 [egl-46p::NLS::DsRed + ttx-3p::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Transcriptional reporter for egl-46 contains NLS::DsRed fused to 4477 bp intergenic DNA. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NG144 |
C. elegans |
ina-1(gm144) III. Show Description
Pvul, occasional lateral vulvae. CAN migration defective.
|
|
| NG2267 |
C. elegans |
fax-1(gm27) lon-2(e678) X. Show Description
Unc and Lon. ME2-3.
|
|
| NG2324 |
C. elegans |
ina-1(gm86)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys (e1259 is ts) and L1-L2 lethals which have an abnormal head (often notched) and are Ham.
|
|
| NG2517 |
C. elegans |
him-5(e1490) V; gmIs5. Show Description
gmIs5 [ina-1::GFP + rol-6(su1006)]. Rollers. ina-1(gm86) may still be in the background.
|
|
| NG2535 |
C. elegans |
cam-2(gm124) I. Show Description
Recessive. Small, moderate Unc. 10% Muv. CAN cell migration defects. Clr.
|
|
| NG2837 |
C. elegans |
dpy-5(e61)/unc-73(gm40) I. Show Description
Heterozgyotes are WT and segregate WT, Dpys and Uncs. Recombination occurs in this strain so pick individual WT animals and score the progeny for both Dpys and Uncs.
|
|
| NG33 |
C. elegans |
unc-73(gm33) I. Show Description
EXTREMELY sick - Ham, lateral vulvae, grow at 20C. Very difficult to maintain. CGC received new stock 1/01.
|
|
| NG4370 |
C. elegans |
zdIs5 I; pig-1(gm344) IV. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I.
|
|
| NG83 |
C. elegans |
fax-1(gm83) X. Show Description
Unc-forward kinker. Recessive.
|
|
| NH2044 |
C. elegans |
egl-15(ay1) X. Show Description
Egl. Maintain under normal conditions. Reference: Chen EB, et al. Dev Biol. 1997 Feb 1;182(1):88-100.
|
|
| NH2103 |
C. elegans |
egl-17(ay6) X. Show Description
Egg-laying defective. Null allele. Maintain under normal conditions. Reference: Burdine RD, et al. (1997) PNAS 94(6):2433-7.
|
|
| NH2192 |
C. elegans |
egl-17(ay8) X. Show Description
Egg-laying defective. Null allele. Maintain under normal conditions. Reference: Burdine RD, et al. (1997) PNAS 94(6):2433-7.
|
|
| NH2447 |
C. elegans |
ayIs2 IV. Show Description
ayIs2 [egl-15p::GFP + dpy-20(+)] IV. GFP expression in vm1 sex muscles and other miscellaneous cells.
|
|
| NH2466 |
C. elegans |
ayIs4 I; dpy-20(e1282) IV. Show Description
ayIs4 [egl-17p::GFP + dpy-20(+)] IV.
|
|
| NH3027 |
C. elegans |
ncl-1(e1865) III; egl-15(n1456) X; ayEx86. Show Description
ayEx86 [col-19::GFP + egl-15(+) (NH#112) + ncl-1(+)(c33c3)]. Maintain by picking non-Egl. Referene: Lo TW, et al. Dev Biol. 2008 Jun 15;318(2):268-75.
|
|
| NIC1070 |
C. sp. 43 |
Caenorhabditis sp. 43 wild isolate. Show Description
Male-Female strain. Do not keep below 20C. Reference (type) isolate for Caenorhabditis sp. 43. Gonochoristic species; isofemale line. Isolated from rotting berries in Chichén Itzá, Yucatán, Mexico (2014).
|
|
| NIC113 |
C. guadeloupensis |
Caenorhabditis guadeloupensis wild isolate. Show Description
Caenorhabditis sp. 20 Male-female. Maintain by mating. Isolated by Christian Braendle from rotten Heliconia flowers, Souffriere Forest trail Guadeloupe (16.0328, -61.676) in March 2010.
|
|
| NIC203 |
C. tropicalis |
Caenorhabditis tropicalis wild isolate. Show Description
Caenorhabditis tropicalis wild isolate. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| NIS1011 |
C. elegans |
kytEx1011. Show Description
kytEx1011 [rheb-1p::rheb-1::GFP + rol-6(su1006)]. rheb-1 fragment was cloned into pPD95-75. Pick Rollers to maintain. Reference: Honjoh S, et al. Nature. 2009 Feb 5;457(7230):726-30.
|
|
| NIS1012 |
C. elegans |
kytEx1012. Show Description
kytEx1012 [hsp-12.6p(1kb)::hsp-12.6::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Honjoh S, et al. Nature. 2009 Feb 5;457(7230):726-30.
|
|
| NIS1013 |
C. elegans |
kytEx1013. Show Description
kytEx1013 [hsp-12.6p(5kb)::hsp-12.6::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Honjoh S, et al. Nature. 2009 Feb 5;457(7230):726-30.
|
|
| NJ228 |
C. elegans |
mua-6(rh85) X. Show Description
Poorly growing strain; most homozygotes fail to reach adulthood, and those that do are Egl. smg suppressable and tends to accumulate second site mutations that suppress the Mua phenotype and restore vigorous growth.
|
|
| NJ261 |
C. elegans |
dpy-24(rh97) I. Show Description
DTC reflexes but goes wrong way dorsal.
|
|
| NJ523 |
C. elegans |
cul-1(rh173) dpy-18(e499) III. Show Description
cul-1 was formerly known as lin-19.
|
|
| NJ524 |
C. elegans |
mua-2(rh174) dpy-18(e499) III. Show Description
Mua, late L4, tail first. Ventral cord abnormal.
|
|
| NJ545 |
C. elegans |
mua-4(rh177) dpy-17(e164) III. Show Description
Mua, not viable. Cytokinesis is defective in both hypodermis and germline resulting in mutinucleate cells.
|
|
| NJ555 |
C. elegans |
exc-3(rh207) X. Show Description
Excretory canal defect. Canals are shortened and animal is somewhat pale. Defect visible only by Nomarski microscopy. Tail spike is often malformed.
|
|
| NJ582 |
C. elegans |
cul-1(e1756)/unc-69(e587) III. Show Description
Heterozygotes are WT and segregate WT, Unc and Long Thin Steriles (that arrest before the adult stage). cul-1 animals have excess cell divisions in post-L1 blast cell lineages. cul-1 was formerly known as lin-19.
|
|
| NJ602 |
C. elegans |
ifc-2(rh209) X. Show Description
Homozygous viable, but poor growth and some mortality at lower osmolarity. Large fluid-filled cysts in excretory cell body and shortened canals, sometimes visible with dissecting microscope. Encodes intermediate filament protein. ifc-2 formerly known as exc-2. References: Buechner M, et al. Dev Biol. 1999 Oct 1;214(1):227-41. doi: 10.1006/dbio.1999.9398. PMID: 10491271.
|
|
