Search Strains

Resistant when fed dsRNA. Contains a point mutation at position 13832 (c to t) (R1000 STOP).

Resistant to feeding dsRNA but sensitive to dsRNA injection. PKA rsd-8.

pkIs1604 [hsp-16.2::ATG(A)17GFP::LacZ + rol-6(su1006)]. Rollers.

pkIs1605 [hsp-16.2p::GFP::LacZ + rol-6(su1006)]. Rollers.

Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat. AKA mut-8.Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat.Mutator.

pkIs32[pie-1::GFP::H2B]. RNAi hypersensitive.

Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc.

pkIs1600 [dpy-30::GFP(truncated) + rol-6(su1006)] I. ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Rollers.

Superficially wildtype.

pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.

pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. YFP expression in the muscles. unc-119 was in the background, but it may have been crossed out.

Deletion sequence: Flanking undeleted sequence in uppercase, deleted sequence in lower case: CGGTGAATCTggaaagtccacg . . . aaatgcttatTCACAATGTT .

F55H2.

jsIs219 [(pSY3) sng-1::GFP + rol-6(su1006)]. Rollers.

Unc. Maintain under normal conditions. Reference: Hawasli A, et al. Genetics. 2004 Oct;168(2):831-43.

Superficially wild-type. Maintain under normal conditions. Reference: Deke SL, et al., J Neurosci. 2005 Jun 22;25(25):5975-83.

Superficially wild-type. Maintain under normal conditions. Reference: Deke SL, et al., J Neurosci. 2005 Jun 22;25(25):5975-83.

jsIs1 [(pSB120) snb-1::GFP + rol-6(su1006)]. Rollers. GFP expressed in the nerve ring, ventral cord and dorsal cord. Received new stock 3/10/2008 from Mike Nonet. Faint signal using a dissecting microscope. Obvious signal using a compound microscope (40X oil).

jsEx1028 [aex-4p::GFP::aex + myo-2p::GFP + pBS]. Pick GFP+ to maintain. Reference: Mahoney TR, et al. Proc Natl Acad Sci U S A. 2008 Oct 21;105(42):16350-5.

jsIs973 [mec-7p::mRFP + unc-119(+)] III. jsIs609 [mec7p::mtGFP + lin-15(+)] X. Strong RFP cytosolic marker for the mechanosensory neurons (Zheng et al. 2011, PMID 21115607). GFP mitochondrial marker expressed in mechanosensory neurons (Mondal et al. 2012, PMID 23051668).

jsIs973 [mec-7p::mRFP + unc-119(+)] III. Strong RFP cytosolic marker for mechanosensory neurons (Zheng et al. 2011, PMID 21115607).

jsIs1 [(pSB120) snb-1::GFP + rol-6(su1006)]. Roller. Unc. GFP expressed in the nerve ring, ventral cord, dorsal cord.

Aldicarb resistant. Lethargic Unc - jerky especially in backward movement. Low pumping rate. Molecular lesion for md247 is a 20 bp duplication yielding a frameshift mid-way through the transmembrane domain.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. jsTi1453 is an RMCE landing site inserted using miniMos on Chr I at 11,933,068 ( at 13.1 m.u.) between R06C1.4 and R06C1.6. Insertion site ccctactatcaacgcaaaaactatttggcttttactTAaacataacgttttgaatttgaaaatcaaaaag with rpl-28p trancription toward R06C1.4. bqSi711 expresses nNeonGreen in germline and early embryo. Reference: Nonet ML. Genetics. 2020.

jsTi1490 [LoxP::mex-5p::FLP::SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsTi1490 is an RMCE landing site inserted using miniMos located on Chr IV at 7,310,985 (at 3.32 m.u.) between glr-4 and F42C5.8. Insertion site gtacataaattataccaaatattgaTAaaagctacgaaaattccactgatat with rpl-28 transcription towards F42C5.8. Reference: Nonet ML. Genetics. 2020.

jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsTi1493 is an RMCE landing site inserted using miniMos located on Chr IV at 9,197,338 (at 4.11 m.u.) inserted between C46C2.7 and wnk-1. Insertion site gttcgcaaaccgtctgcgtctctTAttctcttgcaattccgcgcacacac with rpl-28 transcription toward C46C2.7. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsTi1453 is an RMCE landing site inserted using miniMos located on Chr I at 11,933,068 (at 13.1 m.u.) between R06C1.4 and R06C1.6. Insertion site ccctactatcaacgcaaaaactatttggcttttactTAaacataacgttttgaatttgaaaatcaaaaag with rpl-28p trancription toward R06C1.4. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1554 [LoxP::mec-4p::QF2::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF2 driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsSi1784 [mex-5p::FLP D5::SL2::mNeonGreen::glh-2 3' UTR + Cbr-unc-119(+) attL rps-7 3' mex-5p::phiC31::glh-2 3' FRT3] IV. Inserted at cxTi10882 on IV. Transgene expressing FLP and phiC31 recombinases and mNG in the germline for performing Recombination Mediated Insertion (RMI) transgenesis and Recombination Mediated Homolog Exchange (RMHE). Reference: Nonet ML. bioRxiv 2024.03.01.583017.

jsSi1822 [loxP mex-5p phiC31 sl2 mNG glh-2 3’ FRT3] II. Insertion is on Chr II at 0.77 mu adjacent to ttTi5605. Him. Strain expressing phiC31 and mNG in the germline for performing phiC31 mediated recombination. Reference: Nonet ML. bioRxiv 2024.03.01.583017.

jsSi2615 [loxP attP rps-7 3' FRT3] II. jsSi1784 [mex-5p::FLP D5::SL2::mNeonGreen::glh-2 3' UTR + Cbr-unc-119(+) attL rps-7 3' mex-5p::phiC31::glh-2 3' FRT3] IV. Expressses phiC31 and FLP recombinases and mNG in germline. Strain contains an unmarked phiC31 attP landing site on Chr II. Reference: Nonet ML. bioRxiv 2024.03.01.583017.

jsSi2682 [attP mex-5p::FLP::SL2::mNeonGreen::UTR Cbr-unc-119(+) attL::mex-5Kp::phiC31] IV. Inserted at cxTi10882 on IV. Transgene expressing FLP and phiC31 recombinases and mNG in the germline for performing Recombination Mediated Insertion (RMI) transgenesis and Recombination Mediated Homolog Exchange (RMHE). Reference: Nonet ML. bioRxiv 2024.03.01.583017.

cdIs97 [pcc1::mCherry::cup-5 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::CUP-5 expressed in front coelomocyte promoter.

cdIs113 [pcc1::mCherry::rab-5 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::RAB-5 expressed in front coelomocyte promoter.

cdIs131 [pcc1::GFP::rab-5 + myo-2p::GFP + unc-119(+)]. Ballistic transformation. GFP::RAB-5 expressed in front coelomocyte promoter.

cdIs141[pcc1::mCherry::rab-7 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::RAB-7 expressed in front coelomocyte promoter.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Gee, K et al. (2017) G3 7: 991.

cdIs10 [pcc1::cup-4::GFP + rol-6(su1006)]. Rollers.

cdIs28 [pcc1::mRFP::TRAM + unc-119p::ttx-3::GFP].

cdIs29 [pcc1::GFP::TRAM + unc-119p::ttx-3::GFP].

cdIs36 [pcc1::C31E10.7::GFP + myo-2p::GFP + unc-119(+)]. Ballistic transformation. C31E10.7::GFP (smooth ER marker) expressed in front coelomocyte promoter.

cdIs39 [pcc1::GFP::rme-1(271alpha1) + myo-2p::GFP + unc-119(+)].

cdIs40 [pcc1::GFP::cup-5 + myo-2p::GFP + unc-119(+)]. Ballistic transformation. cup-5::GFP expressed in front coelomocyte promoter.

cdIs54 [pcc1::MANS::GFP + myo-2p::GFP + unc-119(+)]. Ballistic transformation. Mannosidasell::GFP (Golgi marker) expressed in front coelomocyte promoter.

cdIs73[RME-8::mRFP + ttx-3::GFP + unc-119(+)]. Ballistic transformation. RME-8::mRFP expressed in front coelomocyte promoter.

cdIs80 [pcc1::PLCd::GFP + rol-6(su1006)]. Rollers.

cdIs85 [pcc1::2xFYVE::GFP + myo-2p::GFP + unc-119(+)]. Ballistic transformation. 2xFYVE(Hrs)::GFP expressed in front coelomocyte promoter.

qnIs303 [hsp-16.2p::flp-13 + hsp-16.2p::GFP + rab-3p::mCherry] IV. When cultivated at 20 degrees, all animals have red nervous systems. Following heat shock, animals are immobile, do not feed, and show green fluorescence in somatic cells. Reference: Nelson MD, et al. Curr Biol. 2014 Oct 20;24(20):2406-10.

qnIs303 [hsp-16.2p::flp-13 + hsp-16.2p::GFP + rab-3p::mCherry] IV. Pumps and moves 2 hours after heat induced flp-13 over-expression. Outcrossed 1x to NQ570. Reference: Iannacone M, et al. eLife 2017.