Search Strains

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kvs-4. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gttcctaacatgattgttgaaaataattttccagAA right flanking sequence: GCACGGAGGAGGAGCGACGCACAGTGCAGACAGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCGCTCCTCCTCCGTGCTTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-46. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTCGTTTATTGTTTCTGTAGGACCCCTTGCCTCAA right flanking sequence: TACTTCGACCGGCTATTCAGAATACTGTCAACGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATAGCCGGTCGAAGTATTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-116. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTAATTTCCGCAGTTTCAATATTTGGTGCCCTAT right flanking sequence: GTGTGGCAGCTTCAATTTTAGTTGGTATTAACGAA inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATATTTGGTGCCCTATGTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTTGTCGCCGTTGTCTCTGTTTTCATCACATTGC right flanking sequence: CAATGGTTTATAACTATGTTAATAATGTGAAGAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTTTCATCACATTGCCAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ufd-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. Left flanking sequence: CAATTTCCCATGTTATTGAAGCCCACAAATCCGACA. Right flanking sequence: CAAAGGCTTTGGCAGTTACTCAAGGCGGATGCTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCCCACAAATCCGACACAA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C15C8.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATCGGCGCACAACAAGAAAACACAGTATCGAACG. Right flanking sequence: GAACGGATCAACTTCATTTACGAAAAGGCATTGCAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACACAGTATCGAACGGAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C15H9.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTATCTCCACAATAACAGGGAAATTTCACCATTT. Right flanking sequence: GGCATTGAGGgtttgtaaaaatattaaataaacaag. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACAAACCCTCAATGCCAAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C16A11.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTATCTCCACAATAACAGGGAAATTTCACCATTT. Right flanking sequence: CAATGGATGCGAAATGCACGTTGGCTGAATATGTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGCAATGTTTAATCTTTCAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C18B12.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGAAGAAGAATTAGTGCATAAATGTTTGGCGAA. Right flanking sequence: AGGTGGAAATTTTGGAATGGATGTTTCGGATTTTATC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATAAATGTTTGGCGAAAGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C24A3.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagACCGTCCGGGCAAGGACCTAAAGCACCAAAA. Right flanking sequence: GAAGGGCATGCGGTTACACCAAAGgtaaactatttatc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAACCGCATGCCCTTCTTT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C31E10.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGACCGTAAATTCTACAATAACTGGAAAGCCATTG. Right flanking sequence: AGCACTTTCCACGAGGTTATTCTGCATCAACTTTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACCTCGTGGAAAGTGCTCAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F26G1.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCCCGAAAATTCGAAACCGACCCGGATTTGGTAA. Right flanking sequence: TTCCGGCCGTTCAACACCCGTTAGAAGACGCAGAAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGACCCGGATTTGGTAATTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of itm-2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTGTGCGAGGCTGATGAGGAGAAGCACATCAGTAA. Right flanking sequence: CTGCGGCTGGGTACCAATGGAAGGAGGCAACTTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GAGAAGCACATCAGTAACTG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of sfxn-1.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTCCGCCGATTCTTGCTCGTCTCGTTCCATTT. Right flanking sequence: GCTGCTATTGCATTCGCCAATGCAATTAATATTCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCGAATGCAATAGCAGCAAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F22G12.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: caccaaaacccaaccaatttccagAGAACCTTTCGG. Right flanking sequence: CAATGGATTTCCTGCTCGGCAACGGAGCCGATGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCCAGAGAACCTTTCGGCAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. Penetrance lethal with lots of unhatched eggs and slow growth. CRISPR/Cas9 engineered STOP-IN null mutant of hint-3 into hint-1(sy1567) stop-in mutant. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: catgttttacaggATGACGTCAATGCATACTTCTGT. Right flanking sequence: TAACGGATGCAAGTTTTGTGACATTGTCAAAAATA. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCAATGCATACTTCTGTTAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

The fld-1(et46) loss-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. fld-1(et46) carries a mutation in the splice acceptor site of intron 4, i.e. G>A. It can be detected using PCR with annealing at 65°C and using the following primers: et46_WT: atcccccaaaaaacccaatttttttgtag; et46_mut:atcccccaaaaaacccaatttttttgtaa; et46_rev: CCGGAATTGAGACCACctggaac. Expected product size: 389. Reference: Ruiz M, et al. eLife 7:e40686. PMID: 30509349

This double mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093

This triple mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The acs-13(et54) mutation (G125R) can be detected using PCR with the following primers: WT FWD: 5´CTA CCA GGG TGT TCG CCA TG 3; acs-13 mutant FWD: 5´CTA CCA GGG TGT TCG CCA TA 3; acs-13 REV: 5´TCA AAC TTG GGC ATT GCT CC 3´. Annealing 65°C, expected product 395 bp. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093

T19D2.1. Homozygous. Outer Left Sequence: GAGGAAATCGCGATGAAGAG. Outer Right Sequence: TCTCCGCAGTTTACAGAGCA. Inner Left Sequence: AGAGTTGGCTGTATTTGCGG. Inner Right Sequence: CGGCACATTCTGAAAGTCAA. Inner Primer WT PCR Product: 3298. Deletion size: 1666 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK455.1. Previously called gei-22. Homozygous. Outer Left Sequence: CACACACAAAAACGGACAGG. Outer Right Sequence: TCGTTGCTCCAAATCACAAA. Inner Left Sequence: AGACGAGCTTCCAATCTCCA. Inner Right Sequence: TTCCTCCGTTGCGGTAATAG. Inner Primer WT PCR product: 2984. Deletion size: 540 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08E3.4. Homozygous. Outer Left Sequence: GGATGGACTCGAACCAAAAA. Outer Right Sequence: TTCTGGAGGGTCTCTGCCTA. Inner Left Sequence: TTGCAGGAAACACAACGAAG. Inner Right Sequence: CAAATTTGCCATATGTTGCG. Inner Primer WT PCR product: 2983. Deletion size: 1146 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C10.12. Homozygous. Outer Left Sequence: GAGAAAGTGAGCTCCGCAAT. Outer Right Sequence: GCCTACAAAAATGCCATTCG. Inner Left Sequence: ATCACATCGAGGCAAGCTCT. Inner Right Sequence: CAATCGATACAAGCAGCCAA. Inner Primer WT PCR Product: 2693. Deletion size: 635 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11C7.4 Homozygous. Outer Left Sequence: TGAATCTTTGCAATTCGTGG. Outer Right Sequence: CTTGGTGTTCAACATGACCG. Inner Left Sequence: ATTGGCAAACGATTTTCTCG. Inner Right Sequence: CAGTCAACGGACAGCTTGAA. Inner Primer WT PCR Product: 3232. Deletion size: 843 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T09A12.4. Homozygous. Outer Left Sequence: GGTATCTGCCTTGTTCTGCC. Outer Right Sequence: GAAACGATGCTCATGCTCAA. Inner Left Sequence: AACCGCGAACAACGAGTTAC. Inner Right Sequence: CAGGGGAACCGCTAGACATA. Inner Primer WT PCR product: 3091. Deletion size: 1317 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27A10.7. Homozygous. Outer Left Sequence: TCCATGCGAATTGTTGAAAA. Outer Right Sequence: ATCCGCATCTGAATGAGCTT. Inner Left Sequence: TGTCTCCACTGCTAACACGC. Inner Right Sequence: CCGCCCATCAAAAAGATAAA. Inner Primer WT PCR product: 2628. Deletion size: 1242 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01B10.1. Homozygous. Outer Left Sequence: TTGTTTGAACATCTCGCTGC. Outer Right Sequence: CGGTTTTGGGAGGATGAATA. Inner Left Sequence: TTGGGGCTCACTCTCACTTT. Inner Right Sequence: CCGTAGGGGTGCAAAACTAA. Inner Primer WT PCR product: 3101. Deletion size: 789 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03E9.3. Homozygous. Outer Left Sequence: AAAATGGCGAAAGGGCTAGT. Outer Right Sequence: CGGAACTACGGTAAATGCGT. Inner Left Sequence: GCCGACATTTTGGAAAAGAA. Inner Right Sequence: TTTTGCCGTTCTAGGTGTCC. Inner Primer WT PCR product: 2667. Deletion size: 1196 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03E9.3. Homozygous. Outer Left Sequence: AAAATGGCGAAAGGGCTAGT. Outer Right Sequence: CGGAACTACGGTAAATGCGT. Inner Left Sequence: GCCGACATTTTGGAAAAGAA. Inner Right Sequence: TTTTGCCGTTCTAGGTGTCC. Inner Primer WT PCR product: 2667. Deletion size: 832 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C32E12.3. Homozygous. Outer Left Sequence: CGAATATTCCCGAAAAACGA. Outer Right Sequence: CCACGACTTCTCCCTTTCAA. Inner Left Sequence: AATCCCAGTGCAGGCATATC. Inner Right Sequence: ATTTCCAGCACCATTATCGG. Inner Primer WT PCR product: 2824. Deletion size: 983 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09G4.1. Homozygous. Outer Left Sequence: CATAGGCGGTCTAGGAGCAG. Outer Right Sequence: ATGGCGAGCTTTTCTGTCAT. Inner Left Sequence: GCCCCGTAAATAAGCACAAA. Inner Right Sequence: TCGTGTTCTTTCACGTCTCG. Inner Primer WT PCR Product: 2824. Deletion size: 863 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M04F3.4. Homozygous. Outer Left Sequence: GCGAGAAACTGAAGTCGGTC. Outer Right Sequence: ATCCAGCACATCCACAACAA. Inner Left Sequence: GTCAGGAACTGCTCGTAGCC. Inner Right Sequence: ATGGTCAAGCTTCAGCGACT. Inner Primer WT PCR Product: 2480. Deletion size: 328 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17E7.5. Homozygous. Outer Left Sequence: TTCTTGTGCGAAAAATTCCC. Outer Right Sequence: TATGCACCAAACACGCAAAT. Inner Left Sequence: CTCAGACAACTGTGGCGAAA. Inner Right Sequence: ATTGCGCAACGTGAATTTTT. Inner Primer PCR Length: 3294 bp. Deletion Size: 1242 bp. Deletion left flank: AAAACTCCATAAAAATTACCTTTTTAAAAA. Deletion right flank: ACACAGTAGTGTTTAAGCAAGATTTTCTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53F4B.2. Homozygous. Outer Left Sequence: GAATGAGGCGTAGATTCCGA. Outer Right Sequence: ATTTTCAGCATGCGACCTCT. Inner Left Sequence: TTGTTGGCACATCTGGAAAA. Inner Right Sequence: TCTCACGAAAAACCAGGTGA. Inner Primer WT PCR Product: 3162. Deletion size: 1227 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06B3.8. Homozygous. Outer Left Sequence: CCTAACAACGAACACGGCTT. Outer Right Sequence: GCATTCGGCAATTGGTTATT. Inner Left Sequence: ACACGCACCAATCAACTGAA. Inner Right Sequence: GCGAAGATACGTGGACACAA. Inner Primer WT PCR Product: 3151. Deletion size: 1988 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C48B4.2. Homozygous. Outer Left Sequence: CCCATCGAGAGAATTGGAAA. Outer Right Sequence: ATGCGTGAAGGAAAACCTGT. Inner Left Sequence: CGGAGATGAACAGAGCACAA. Inner Right Sequence: CAGATGAGCAAATGCAAAGG. Inner Primer WT PCR product: 2823. Deletion size: 530 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R05F9.10, R05F9.1b. Homozygous. Outer Left Sequence: TTGTAAGGGGAAATTCTGCG. Outer Right Sequence: TGACGAGGGACACACAAAAA. Inner Left Sequence: AGGAGATTGGCGGAAGAGAT. Inner Right Sequence: AGTCGCAGGTTTAGCTCCAA. Inner Primer WT PCR Product: 3317. Deletion size: 2275 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y37H9A.6. Homozygous. Outer Left Sequence: CATATTGCCCAGAAATGGCT. Outer Right Sequence: CCGAGAAGCTTTTGCTCTGT. Inner Left Sequence: AGTGGCAAAAATGGCAAAAA. Inner Right Sequence: GATTTGAAGCCCAAAGAGCA. Inner Primer WT PCR Product: 2133. Deletion size: 785 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H01A20.1. Homozygous. Outer Left Sequence: CCCTGTATTCCTCGCATTGT. Outer Right Sequence: GGACAAACACGAGACCGAGT. Inner Left Sequence: TTGATGGCCTGTCATCTGAA. Inner Right Sequence: CCCGTCACAATGAAACACTG. Inner Primer WT PCR Product: 3070. Deletion size: 1296 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07E5.15, R07E5.17. Homozygous. Outer Left Sequence: TCACGGTCATCGATTGGTTA. Outer Right Sequence: TGGCCCGGTATCACAATAAT. Inner Left Sequence: CTTGAAAAGCAACTCGGACC. Inner Right Sequence: CGGAAAATTCGACCAGAGAA. Inner Primer WT PCR Product: 2236. Deletion size: 992 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59E12.13 Homozygous. Outer Left Sequence: GAAAGTTCCAATGGGCTCAA. Outer Right Sequence: TCAACATTTTGAGCAGACGC. Inner Left Sequence: TCGTTGTCAAACCATTTCCA. Inner Right Sequence: TTGAAACCGCCAAGTGATTT. Inner Primer PCR Length: 3345. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14F3.3 Homozygous. Outer Left Sequence: GGAGCGAGAAAATGGTTTTG. Outer Right Sequence: GCAGTCATCGCATTCCTTTT. Inner Left Sequence: GATGCAAAGGGCGAAAATAA. Inner Right Sequence: TAGTAATGCGTCCGCAAACA. Inner Primer PCR Length: 2829. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10D11.1 Homozygous. Outer Left Sequence: ACTGCTCGACAGACTCCGAT. Outer Right Sequence: GACGCATTCACCAACAAATG. Inner Left Sequence: TCGAGGCTGGAACTTCAACT. Inner Right Sequence: CCCCTAATAACTGCACCGAA. Inner Primer PCR Length: 2320. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11H6.1 Homozygous. Outer Left Sequence: CTTCGATGAGACAGCCACAA. Outer Right Sequence: TTACTGGAAGTTTCCCCGTG. Inner Left Sequence: CAACGGCAACAAGATTAGGG. Inner Right Sequence: GTGAAGCAGTGGCAATTCAA. Inner Primer PCR Length: 2301. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK757.3 Homozygous. Outer Left Sequence: GGATTTGGTCCGAAGTAGCA. Outer Right Sequence: GCCGATGATCAAGGATCTGT. Inner Left Sequence: GAGTTGGAATGGAGACCGAA. Inner Right Sequence: CAATATGCGTGAGGTGGTTG. Inner Primer PCR Length: 2888. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12G11.2 Homozygous. Outer Left Sequence: TGTCAGGTGGAATACGACGA. Outer Right Sequence: ACATATTCCGAAAAGTGCCG. Inner Left Sequence: TGTTCCATTCACTTCCGTCA. Inner Right Sequence: TGCACGTACACATTCTGCAA. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B10.1a Homozygous. Outer Left Sequence: GCAATCAAAGTTTCCAGCGT. Outer Right Sequence: CCTTGTCCTACTCAGCCAGC. Inner Left Sequence: AGATAAAGTCGGCAACCTGC. Inner Right Sequence: CAAATGGCGATCTGTACCCT. Inner Primer PCR Length: 3224. Estimated Deletion Size: about 1900 bp. From Nathalie Pujol 11/04: breakpoints, with a 8 bases insertion, AAATGTCGCCGGATCGTGAACTTGCAAGAAT/AGAATAAA/TGTAGACAGTGCTGGCGT AATTCGCCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R09F10.4 Homozygous. Outer Left Sequence: TTGCAAGCATTATTTGCGAG. Outer Right Sequence: ATTCCATTTTCCCATCCTCC. Inner Left Sequence: GGCAGCTTGACACAATTGAA. Inner Right Sequence: TTATTGCCGGTGGTTCTGAT. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03D10.1 Homozygous. Outer Left Sequence: TTTTCCGGAAGATTCCAGTG. Outer Right Sequence: AAAAATGCGGGAATGTTTTG. Inner Left Sequence: GCTGAAAAATCGTGGGAAAA. Inner Right Sequence: CCCATTTTCTTTTGCAGGAA. Inner Primer PCR Length: 2786. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E02H1.2 Homozygous. Outer Left Sequence: TTTTCCAAGGTGGACCAAAG. Outer Right Sequence: CTTTTCTCGACGGCTTCAAC. Inner Left Sequence: TTGCTAGGGAGCATCCAAGT. Inner Right Sequence: CCCAATACAACCAGCAACAA. Inner Primer PCR Length: 2359. Estimated Deletion Size: about 350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807