Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB1219 C. elegans ZC449.3a(ok1276) X. Show Description
ZC449.3a Homozygous. Outer Left Sequence: aagaaatagaggcggtcggt. Outer Right Sequence: ggtgcatgggaatttgtttc. Inner Left Sequence: tttcaaccacacgccaaata. Inner Right Sequence: aagttgagacggacgaggaa. Inner Primer PCR Length: 2725. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1227 C. elegans Y49E10.20(ok1286) III. Show Description
Y49E10.20 Homozygous. Outer Left Sequence: cttcttttcgcgtgctctct. Outer Right Sequence: gacaagactagtccgccagc. Inner Left Sequence: gcgggatttcgtcaaaataa. Inner Right Sequence: tcagcaagattttctcggct. Inner Primer PCR Length: 3106. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1229 C. elegans cyc-1(ok1258) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C54G4.8 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: ccgaagaattccgaatcaaa. Outer Right Sequence: tatcggcgcaagctactttt. Inner Left Sequence: tttggcgtcgaagaataacc. Inner Right Sequence: atgctgaggatcggattttg. Inner Primer PCR Length: 2598. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1232 C. elegans K04F10.1(ok1291) I. Show Description
K04F10.1 Homozygous. Outer Left Sequence: TGGTGAAATTCCATCAAGCA. Outer Right Sequence: GCATTGAGCTGTGCTGAAAA. Inner Left Sequence: AGTGGAAACCGAAGTTGTGC. Inner Right Sequence: CTCGAGCGAGTCGAGTTTTT. Inner Primer PCR Length: 2128. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1233 C. elegans T22H9.4(ok1294) V. Show Description
T22H9.4 Homozygous. Outer Left Sequence: gtggctgaaaattcggaaaa. Outer Right Sequence: tactgatccgcgtaaaaccc. Inner Left Sequence: aaaatcaatcggtttcagcg. Inner Right Sequence: gcggagacgttagacatggt. Inner Primer PCR Length: 2135. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1235 C. elegans T28C6.1(ok1264) IV/nT1 [qIs51] (IV;V). Show Description
T28C6.1 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms as the balancer may break down. ok1264 animals are homozygous viable. Outer Left Sequence: TCCCTGTTCCATTTTTGAGC. Outer Right Sequence: CATCACCTCTACCACCCCAT. Inner Left Sequence: AAGCCAAGAATTCGCAAAAA. Inner Right Sequence: CAACACCACCATGACCTGAA. Inner Primer PCR Length: 2241. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1238 C. elegans hmg-11(ok1303) II. Show Description
T05A7.4 Homozygous. Outer Left Sequence: ctcgtggaagccctagacag. Outer Right Sequence: catcgggaaagtacggaaga. Inner Left Sequence: tcagatggtatgatcgccaa. Inner Right Sequence: tcagactgtcacatcgctcc. Inner Primer PCR Length: 2185. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1239 C. elegans F36A2.4(ok1304) I. Show Description
F36A2.4 Homozygous. Outer Left Sequence: ATGTGGATATCGACCCGAAA. Outer Right Sequence: CAGTCCTGATTTTGGAGGGA. Inner Left Sequence: GTCGAATCGAAGATCAGGGA. Inner Right Sequence: AGTTGGCAAATGATTCGGAG. Inner Primer PCR Length: 2524. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1241 C. elegans ZK337.2(ok1306) I. Show Description
ZK337.2 Homozygous. Outer Left Sequence: GGGGAGCCAGAGGTTAAAAG. Outer Right Sequence: TTCTCTCTCACTTCTCCGGC. Inner Left Sequence: ATACGAGCAAGCTCCCTCAA. Inner Right Sequence: GAAGGGTGAAGACACGGAAA. Inner Primer PCR Length: 2572. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1244 C. elegans W04B5.5(ok1309) III. Show Description
W04B5.5 Homozygous. Outer Left Sequence: gaagcgaggtctacagtccg. Outer Right Sequence: cgtcgaaaagaacccaaaaa. Inner Left Sequence: gtggtgggacccatattgag. Inner Right Sequence: tctgcctgaaaaggctgatt. Inner Primer PCR Length: 2929. Estimated Deletion Size: about 330 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1248 C. elegans B0285.8(ok1312) III. Show Description
B0285.8 Homozygous. Outer Left Sequence: aaatcgccaacttccaagaa. Outer Right Sequence: tcgcgaaacattcacttgac. Inner Left Sequence: ttccaaaactctttggctcc. Inner Right Sequence: gaatccggggatttttcagt. Inner Primer PCR Length: 2183. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1249 C. elegans scrm-2(ok1313) I. Show Description
ZK1053.5 Homozygous. Outer Left Sequence: ttgcagatcaaaccatccaa. Outer Right Sequence: ttggaaaatcttgggctcac. Inner Left Sequence: cttccctcttcgtctatgcg. Inner Right Sequence: tttgaaagaattgggttcgg. Inner Primer PCR Length: 2112. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1250 C. elegans acr-21(ok1314) III. Show Description
F27B3.2 Homozygous. Outer Left Sequence: caaaagagggtgtcgggtaa. Outer Right Sequence: aaacaccacaagcaggaagc. Inner Left Sequence: aaactgcagacggagctcat. Inner Right Sequence: tgaaattttgggaggattcg. Inner Primer PCR Length: 2667. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1257 C. elegans T18D3(ok1324) X. Show Description
T18D3. Homozygous. Outer Left Sequence: TTCCCGATATCTCAAAACGC. Outer Right Sequence: TGAATTCCCAAAATTCTCGC. Inner Left Sequence: TGACAAACAAAATGGCCAAA. Inner Right Sequence: CTCAAAGCGGATTAACCCAA. Inner Primer PCR Length: 3055 bp. Deletion Size: 1026 bp. Deletion left flank: AGTCACACAGACAAAAATTGGCATTTACAC. Deletion right flank: AAATAAACAGTCAGAGACTATTTGCGGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1266 C. elegans pct-1(ok1348) IV. Show Description
C07G1.3 Homozygous. Outer Left Sequence: tgtatgtggatgtgcgtgtg. Outer Right Sequence: aaaagcaagctgaaacggaa. Inner Left Sequence: aaatccgtttggagctgttg. Inner Right Sequence: gttttggttgagggagcttg. Inner Primer PCR Length: 2758. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1267 C. elegans D1009.3(ok1349) X. Show Description
D1009.3 Homozygous. Outer Left Sequence: tgaggaatttccattctgcc. Outer Right Sequence: tggcctctccacaactctct. Inner Left Sequence: tgctcttgtagagccccagt. Inner Right Sequence: ggtctgtgatgaggggagaa. Inner Primer PCR Length: 2454. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1271 C. elegans ceh-33(ok1362) V. Show Description
C10G8.7 Homozygous. Outer Left Sequence: ggaaaacaaaaccagggtca. Outer Right Sequence: cacgatcaagaagaatgcca. Inner Left Sequence: gaacggttgttcccagaaaa. Inner Right Sequence: cccgtgcagaggaatctaaa. Inner Primer PCR Length: 2241. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1276 C. elegans sun-1(ok1282) V/nT1 [qIs51] (IV;V). Show Description
F57B1.2 Heterozygotes are WT and GFP+. Outer Left Sequence: tgattcccaggaaccaaaaa. Outer Right Sequence: tctgtgcctgccaaatcata. Inner Left Sequence: aaaacgaaaacggcactttg. Inner Right Sequence: aattacaattccgcacaggc. Inner Primer PCR Length: 2136. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1277 C. elegans gcy-6(ok1293) V/nT1 [qIs51] (IV;V). Show Description
B0024.6 Heterozygotes are WT and GFP+. ok1293 animals arrest in the larval stage. Outer Left Sequence: agggagagggataaggggtt. Outer Right Sequence: tgcaatgccagttttcattc. Inner Left Sequence: gtccgccaaggatttaacaa. Inner Right Sequence: gggggataacttcatcagca. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1278 C. elegans let-502(ok1283) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C10H11.9 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: tcaatgaagcgtcgaagttg. Outer Right Sequence: gatcgagataatgcgggaga. Inner Left Sequence: cgagttcacgagagagaccc. Inner Right Sequence: gccgaagacatttaacggaa. Inner Primer PCR Length: 3323. Estimated Deletion Size: about 1800 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1280 C. elegans F15B9.4(ok1296) V/nT1 [qIs51] (IV;V). Show Description
F15B9.4 Heterozygotes are WT and GFP+. Outer Left Sequence: gactcaaggcgattgctgat. Outer Right Sequence: tgacgcggtaataaatgcaa. Inner Left Sequence: cgatcgttcccctcaaagta. Inner Right Sequence: ttcttgttgcgatgaagtcg. Inner Primer PCR Length: 3243. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1284 C. elegans C30F12.6(ok1381) I. Show Description
C30F12.6 Homozygous. Outer Left Sequence: gtataacacaagcctccgcc. Outer Right Sequence: ggagttccagccattgatgt. Inner Left Sequence: ttttcggtctctaaccacgg. Inner Right Sequence: ttggttcaaagctgttgctg. Inner Primer PCR Length: 3260. Estimated Deletion Size: about 2200 bp. Breakpoint data provided by Neline Kriek 10/2004: TTCTTTGTAAATAACTTTTTACTTTACGTTTTTGAAAACATTCTCGATCTCCAAATCTT CbreakpointATTGGTAATTAAAATCAATAATTTCGATTCAGTGTGATCCCACTTAAA TTTTATACATTG. [NOTE: (March 2019) The Moerman lab confirms that diagnostic PCR with one primer internal to the deletion and one external yields the expected product from N2 and no product from RB1284. Primer sequences (5'->3') were ttttcggtctctaaccacgg and gaaacaagcccactcactac.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1285 C. elegans lys-7(ok1384) V. Show Description
C02A12.4 Homozygous. Outer Left Sequence: ggtttccaaaaagccaacaa. Outer Right Sequence: gtattcagaacgtggcggtt. Inner Left Sequence: tccatcaaaattggcaacaa. Inner Right Sequence: cggcgaaataaattttggaa. Inner Primer PCR Length: 2354. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1286 C. elegans lys-7(ok1385) V. Show Description
C02A12.4 Homozygous. Outer Left Sequence: ggtttccaaaaagccaacaa. Outer Right Sequence: gtattcagaacgtggcggtt. Inner Left Sequence: tccatcaaaattggcaacaa. Inner Right Sequence: cggcgaaataaattttggaa. Inner Primer PCR Length: 2354. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1288 C. elegans C48C5.1(ok1387) X. Show Description
C48C5.1 Homozygous. Outer Left Sequence: ttgccttgcattcaattgtc. Outer Right Sequence: tgctgaatgagcttcttgga. Inner Left Sequence: agtcattcggaaagcgaaaa. Inner Right Sequence: agcagatgaagaaagccgaa. Inner Primer PCR Length: 2844. Estimated Deletion Size: about 1200 bp. Breakpoint data provided by Neline Kriek 10/2004: GATACAGGTTTTAAGAAAACACCACTTGAAAAACGCAGACAACGTAAGATTTAAAACAT GACTCGTTbreakpointAGTCTAGTGGTCTAGTGAACCAGTTTGCAATTTATGGTTTG AATATTTTAATTACTTTTAATAGTTTGTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1289 C. elegans C43C3.2(ok1388) X. Show Description
C43C3.2 Homozygous. Outer Left Sequence: catacccaagtacgcgtgaa. Outer Right Sequence: tgaaagtcaactggtggcag. Inner Left Sequence: ccacgtcgcctgttaagttt. Inner Right Sequence: acagttgcagaagcgagaca. Inner Primer PCR Length: 2850. Estimated Deletion Size: about 900 bp. Breakpoint data provided by Neline Kriek 10/2004: AAGTCANCACTGGAATGCATCTGTATAAGTGTGTCGATGATCTTGGTCGCGAGTTGTTT GTTGTATTTACTTTGTACTbreakpointACGACGAACACCCGACCTGAATATAGCGAG CTAATCGCAATACGTAAGTTGTTATCATTCAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1292 C. elegans aex-3(ok1391). Show Description
C02H7.3 Homozygous. Outer Left Sequence: gtcaacgcgtgaaaaactga. Outer Right Sequence: cagcgtgacagatgcagatt. Inner Left Sequence: gctggagagtaaagttgccg. Inner Right Sequence: ccggtttcttgtagacccaa. Inner Primer PCR Length: 2891. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1294 C. elegans C49G7.8(ok1393) V. Show Description
C49G7.8 Homozygous. Outer Left Sequence: gccaaactttgctaacgctc. Outer Right Sequence: ttagccgaagtagccgaaaa. Inner Left Sequence: aagccttcagacacgctttc. Inner Right Sequence: gaccgattgattttagccga. Inner Primer PCR Length: 2372. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1296 C. elegans C17H12.9(ok1395) IV. Show Description
C17H12.9 Homozygous. Outer Left Sequence: agttcctctgccgcttgtaa. Outer Right Sequence: aagttcggggaatttcgtct. Inner Left Sequence: gcaaccacgtagcttcacaa. Inner Right Sequence: ttggaaatggaatcacccat. Inner Primer PCR Length: 3028. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1302 C. elegans Y2C2A.1(ok1409) IV. Show Description
Y2C2A.1 Homozygous. Outer Left Sequence: tcccatcattctccgaaaag. Outer Right Sequence: gaagaggtggtcgatcagga. Inner Left Sequence: ttgaatgcgtatcggatgaa. Inner Right Sequence: agctcgaggggttttctctc. Inner Primer PCR Length: 3007. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1303 C. elegans D2096.12(ok1410) IV. Show Description
D2096.12 Homozygous. Outer Left Sequence: aaacgaggagggaaacctgt. Outer Right Sequence: ttcatatgcaaaaccggtca. Inner Left Sequence: gatgagaacgcaacaagcaa. Inner Right Sequence: gggcggcaattaaaaacata. Inner Primer PCR Length: 3247. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1311 C. elegans R05D11.8(ok1427) I. Show Description
R05D11.8 Homozygous. Outer Left Sequence: gctgcgtgaacatcaagaaa. Outer Right Sequence: attccaacgacttgccaaag. Inner Left Sequence: tttgaccatggcgaatgtta. Inner Right Sequence: tagagggatcgctggagaaa. Inner Primer PCR Length: 2546. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1313 C. elegans C05C10.2(ok1429) II. Show Description
C05C10.2 Homozygous. Outer Left Sequence: gatgtcatgcgagagatgga. Outer Right Sequence: tggtggcagttgatgaatgt. Inner Left Sequence: gccaaattcgcaacaagaat. Inner Right Sequence: ccaaagcttgcattgttgaa. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1314 C. elegans C05C10.2(ok1430) II. Show Description
C05C10.2 Homozygous. Outer Left Sequence: gatgtcatgcgagagatgga. Outer Right Sequence: tggtggcagttgatgaatgt. Inner Left Sequence: gccaaattcgcaacaagaat. Inner Right Sequence: ccaaagcttgcattgttgaa. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1315 C. elegans C49G7.1(ok1431) V. Show Description
C49G7.1 Homozygous. Outer Left Sequence: cttatgggtttcaccacgct. Outer Right Sequence: cggctggaaaaagttaccaa. Inner Left Sequence: gcaaactcgaaagcagttcc. Inner Right Sequence: agtagcgggcaaaagactga. Inner Primer PCR Length: 2650. Deletion Size: 1045 bp. Deletion left flank: AAAAATGCAACGACCGACTTCAACGGCCACC. Deletion right flank: TTTGTACTGAACTTTCTTAACCAGGTACTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1316 C. elegans unc-105(ok1432) II. Show Description
C41C4.5 Homozygous. Outer Left Sequence: gttatgacgaagagcgaggc. Outer Right Sequence: cgaagaccataattcgctcc. Inner Left Sequence: cgtttgagcacaccttcaaa. Inner Right Sequence: catctctccaactgcgaaca. Inner Primer PCR Length: 3052. Estimated Deletion Size: about 950 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1317 C. elegans srp-3(ok1433) V. Show Description
Y32G9 Homozygous. Outer Left Sequence: ttcacctctttcaattgccc. Outer Right Sequence: gaaaatcgaaattcggcaaa. Inner Left Sequence: ctaagtggtgccactgacga. Inner Right Sequence: tatatcgacccgagccaaac. Inner Primer PCR Length: 2659. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1318 C. elegans Y66D12A.5(ok1436) III. Show Description
Y66D12A.5 Homozygous. Outer Left Sequence: caagcttctcacaccgatca. Outer Right Sequence: gctacgcttcaagaaatccg. Inner Left Sequence: attgctcgaaaagctggaaa. Inner Right Sequence: cggacctcttcatcgtcatt. Inner Primer PCR Length: 2138. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1321 C. elegans C56G3.1(ok1439) X. Show Description
C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Deletion Size: 838 bp deletion with a 1 bp insertion. Sequence across breakpoint from Neline Kriek: tggattggtgataatggctgtagtattgattattaataaccatattccaggaa. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1322 C. elegans F33H2.6(ok1440) I. Show Description
F33H2.6 Homozygous. Outer Left Sequence: acggtgctagattcggaaaa. Outer Right Sequence: tgttcgaaaaaggttttggc. Inner Left Sequence: agatccggaatttcaccaga. Inner Right Sequence: cgggatttttcaccatctgt. Inner Primer PCR Length: 2165. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1327 C. elegans K04G11.4(ok1444) X. Show Description
K04G11.4 Homozygous. Outer Left Sequence: aaccctccacttttgtcacg. Outer Right Sequence: gttaagggcagcaaccaaaa. Inner Left Sequence: tctggcagtgtgcaaatgat. Inner Right Sequence: ggggccttgagaccttatgt. Inner Primer PCR Length: 2137. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1329 C. elegans C56G3.1(ok1446) X. Show Description
C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Estimated Deletion Size: about 779 bp. Sequence across the breakpoint: GGTATGTAGAACTTTTTTTTTGAA-breakpoint-AACAAAATGAGCAAAACTCGTGC . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1330 C. elegans npr-1(ok1447) X. Show Description
C39E6.6 Homozygous. Outer Left Sequence: tcagcaaaattcccgatttc. Outer Right Sequence: gaacctgttagtgggccaag. Inner Left Sequence: gatcaattcttccggctcag. Inner Right Sequence: ggccaaatggaagttgaaaa. Inner Primer PCR Length: 2687. 11/24/04: From Neline Kriek: ok1447 is a 1263 bp deletion with a 1 bp insertion (T). The sequence is: gtatcagcattttcgtatgcacTacgttttgagaagtttcatt. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1337 C. elegans hlh-26(ok1453) II. Show Description
C17C3.8 Homozygous. Outer Left Sequence: ccagttccgcctgtaacatt. Outer Right Sequence: ttgccacgactggatattga. Inner Left Sequence: actcacctctgcaactgcct. Inner Right Sequence: agtgtcacacgctgagatgg. Inner Primer PCR Length: 2179. Deletion Size: 983 bp. Additional information from Casonya Johnson 3/2005: the deletion is 983 bases, from base 2254 to 3237 on the cosmid C17C3. The gene C17C3.8 is on the opposite strand, and its coding region is from bases 3237 to 3616. The deletion occurs within the second exon of the gene, so that the first 105 amino acids of the protein are still made. This region contains one of the two HLH domains produced by this protein but eliminates the second one. The first stop codon would allow another 19 amino acids to be added to the peptide. I have pasted the sequence below (the red, underlined sequences are the new nucleotides). MSSSPTSSSS GSPSSHGHRS ETEKQRRDDT NDLLNEFKKI VQKSESEKLS KEEVLFRIVK LLSGIQLHHE SFSTSPGPIR SIKKIKSDRE QVRRNKRVAA YRELR tiknkhlehvfnffelki stop Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1340 C. elegans nlp-1(ok1469) X. Show Description
C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1341 C. elegans nlp-1(ok1470) X. Show Description
C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1346 C. elegans EEED8.16(ok1492) II. Show Description
vEEED8.16 Homozygous. Outer Left Sequence: acgcgaaagaaagcgaataa. Outer Right Sequence: cttgacacacctgccacatc. Inner Left Sequence: caattttctcgacgaggagg. Inner Right Sequence: tttcatgccagtctattgcg. Inner Primer PCR Length: 2911. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1355 C. elegans T04C9.1a(ok1510) III. Show Description
T04C9.1a Homozygous. Outer Left Sequence: tcttcgcttgtccatatccc. Outer Right Sequence: gcgttttgcaaacaaaaaca. Inner Left Sequence: gactctgcgctcatcacaaa. Inner Right Sequence: ggtctccgtgagcatgattt. Inner Primer PCR Length: 3187. Estimated Deletion Size: about 2150 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1358 C. elegans C06A8.3(ok1525) II. Show Description
C06A8.3 Homozygous. Outer Left Sequence: ctggtcaacttcagcgaaca. Outer Right Sequence: ttggcactcacatcagaagc. Inner Left Sequence: ggacatccctcatcagtcgt. Inner Right Sequence: gtcctttttcaaatccgcaa. Inner Primer PCR Length: 2211. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1359 C. elegans B0024.9(ok1526) V. Show Description
B0024.9 Homozygous. Outer Left Sequence: tcaattgcaatactcgctgc. Outer Right Sequence: aaaaaggctctcgacgtgaa. Inner Left Sequence: gatatattccaggcggctca. Inner Right Sequence: gcaagaagaagacccagtcg. Inner Primer PCR Length: 2109. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807