| RB1144 |
C. elegans |
Y73B6BL.19(ok1168) IV. Show Description
Y73B6BL.19 Homozygous. Outer Left Sequence: tcacttttcgaatggggttc. Outer Right Sequence: ccactttccatttttcccag. Inner Left Sequence: atcttagccagggttgcaga. Inner Right Sequence: tgttgcatacgacgaagagc. Inner Primer PCR Length: 2905. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| BC12514 |
C. elegans |
dpy-5(e907) I; sIs10566. Show Description
sIs10566 [rCes Y73B6BL.19::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| VC4447 |
C. elegans |
shl-1(gk5522[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 3366 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTATACCGGATTCAAAATTTGTGCCCTCT. Right flanking sequence: ATATCACATTGAGAGCTTGTGAACATATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| PS9058 |
C. elegans |
shl-1(sy1614) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of shl-1. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTTCGAGACAGCCCATGCCACAGGCCCCAGTTGCAA right flanking sequence: TACAGgttaggtttggtgggaataattttctaaat inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAGGCCCCAGTTGCAATAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|