| JW106 |
C. elegans |
sup-39(je5) II; syr-1(je11) ?. Show Description
Synthetic Roller after L4 stage (85% penetrance). je5 is dominant and je11 is recessive. See 1996 East Coast Worm Meeting Abstract #80.
|
|
| JZ500 |
C. elegans |
pyIs500. Show Description
pyIs500 [ofm-1p::GFP + odr-1p::DsRed + odr-3p::GFP::egl-4]. Reference: O'Halloran DM, et al. PLoS Genet. 2009 Dec;5(12):e1000761. Lee JL et al. Proc Natl Acad Sci USA. 2010 Mar 30;107(13):6016-21.
|
|
| KA6 |
C. elegans |
lin-15B&lin-15A(n765) X; lkEx1. Show Description
lkEx1 [elp-1::GFP + lin-15(+)]. Animals carrying the aray are superficially wild-type. Pick wild-type to maintain. Maintain under normal conditions. Reference: Hueston JL, et al. BMC Dev Biol. 2008 Nov 17;8:110.
|
|
| KAB111 |
C. elegans |
louIs7. Show Description
louIs7 [ges-1p::sqst-1::mCherry::GFP::unc-54 3'UTR]. Tandemly-tagged p62/sequestosome marker expressed in the gut can be used to monitor autophagic activity. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.
|
|
| KAB122 |
C. elegans |
louIs8. Show Description
louIs8 [ges-1p::nuc-1::mCherry::unc-54 3'UTR]. mCherry-tagged lysosomal nuclease NUC-1 expression can be used to monitor lysosomes in the gut. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.
|
|
| KAB157 |
C. elegans |
louIs10. Show Description
louIs10 [myo-3p::sqst-1::mCherry::GFP::unc-54 3'UTR]. Tandemly-tagged p62/sequestosome marker expressed in the muscle can be used to monitor autophagic activity. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.
|
|
| KAB34 |
C. elegans |
louIs2. Show Description
louIs2 [ges-1p::mCherry::GFP::SKL::unc-54 3' UTR]. Expresses a mCherry::GFP::serine-lysine-leucine peroxisome signal sequence (SKL) fluorescent pexophagy reporter in the C. elegans intestine. Generated in N2 background. Reference: Dolese DA, et al. Autophagy. 2022 Jul;18(7):1522-1533. https://doi.org/10.1080/15548627.2021.1990647 PMID: 34689720
|
|
| KAE112 |
C. elegans |
seaIs201. Show Description
seaIs201 [myo-3p::human tau (0N4R;V337M)::unc-54 3'UTR + vha-6p::mCherry::unc-54 3'UTR]. Reduced crawling speed, reduced brood size, shortened lifespan, slow development, early paralysis. Human tau transgene is expressed in body wall muscles, producing strong phenotypes suitable for screening and is sensitive to knockdown by feeding RNAi. Generated in N2 background.
|
|
| KB10 |
C. elegans |
mir-67(n4899) III. Show Description
MT15982 mir-67(n4899) was outcrossed 6x to produce this strain. Deletion breakpoints are:GGGTGCCTAATGCAAA / AGTACACATTTATGAAT...GCGAGTTTAAAGCAACG / AGTAGCAGAAGGACCA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| KB11 |
C. elegans |
mir-83(n4638) IV. Show Description
MT15501 mir-83(n4638) was outcrossed 6x to produce this strain. Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| KB4 |
C. elegans |
glh-4(gk225) glh-1(ok439) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain balanced stock. Heterozygotes are superficially wild-type GFP+ and segregate wild-type GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP glh-4 glh-1 homozygotes (sterile; incompletely penetrant). NOTE (K. Bennett, 2012): KB4 strain is only 63% sterile at 20C and 92% sterile at 26C (Spike et al., Genetics 2008 178:1973). glh-1(ok439) is not a null allele.
|
|
| KB6 |
C. elegans |
rle-1(cxTi510) III. Show Description
Slowed development. Increased life span. Decreased embyronic viability. Decreased brood sizes.
|
|
| KB7 |
C. elegans |
kgb-1(um3) kgb-2(km16) IV. Show Description
Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)]
|
|
| KC322 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Small (non-Mab). Male-female strain.
|
|
| KC421 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Unc. Male-female strain.
|
|
| KC422 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Dumpy. Male-female strain.
|
|
| KC423 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Uncoordinated (coiler). Male-female strain.
|
|
| KC427 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Unc. Male-female strain.
|
|
| KC431 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Small (non-Mab)/Dumpy. Male-female strain.
|
|
| KC435 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Small (non-Mab)/Dumpy. Male-female strain.
|
|
| KC436 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Dumpy. Male-female strain.
|
|
| KC440 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Dumpy. Slightly Uncoordinated. Male-female strain.
|
|
| KC441 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Dumpy. Male-female strain.
|
|
| KC442 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Dumpy. Male-female strain.
|
|
| KC443 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Dumpy. Male-female strain.
|
|
| KC467 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Unc (coiler). Male-female strain.
|
|
| KC470 |
C. remanei |
Show Description
Male-female strain. Caenorhabditis remanei mutant. Dumpy.
|
|
| KG2730 |
C. elegans |
clu-1(ok2). Show Description
Mild locomotory defects, sluggish response to physical stimuli, and reduced thrashing rate. Phenotype more severe than ok3. ok2 is a 1189 bp deletion (III:9519159-9520346) removing amino acids 314-693 and inserting a glutamic acid at the deletion site. Flanking sequence: GACCGACTTCCAACCAGTTACCCAG...ATGTTATGAAGTTCAATCCGGATTGTTTCTC ATCAAATGT.
|
|
| KG2731 |
C. elegans |
clu-1(ok3). Show Description
Mild locomotory defects, sluggish response to physical stimuli, and reduced thrashing rate. Phenotype less severe than ok2. ok3 is a 1047 bp deletion (III:9518654-9519699) and 13 nucleotude insertion (producing two termination codons) resulting in a protein truncated at amino acid 693 plus an inserted glutamic acid. Flanking sequence: GCTCGAGGATGCTGCTCACAAACTGAAAATG...GAATAGTATCCGTGAATAGTATCCG TGAAGATTCTG.
|
|
| KK112 |
C. elegans |
mel-8(b309) unc-4(e120) sqt-1(sc13)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
mel-8 is a maternal effect lethal. WT heterozygotes (sc13 recessive) segregate WT, MelUncSqt (sick and small), mnC1 dpy-10 unc-52 homozygotes (paralyzed Dpys). Rescued by male mating.
|
|
| KK1216 |
C. elegans |
par-3(it298[par-3::GFP]) III. Show Description
Superficially wild-type. Made in N2 background.
|
|
| KK1218 |
C. elegans |
par-3(it300[par-3::mCherry]) III. Show Description
Superficially wild-type. Made in N2 background.
|
|
| KK1248 |
C. elegans |
par-6(it310[par-6::GFP]) I. Show Description
Superficially wild-type. Made in N2 background. [NOTE: There was an error in the information originally submitted to the CGC for this strain. The correct allele name is par-6(it310), not par-6(it319).]
|
|
| KK1262 |
C. elegans |
par-1(it324[par-1::GFP::par-1 exon11a]) V. Show Description
Superficially wild-type. Made in N2 background.
|
|
| KK1273 |
C. elegans |
par-2(it328[GFP::par-2]) III. Show Description
Superficially wild-type. Made in N2 background.
|
|
| KK157 |
C. elegans |
mel-9(b293) II. Show Description
Maternal effect lethal mutation. Temperature sensitive-grow at 15C. Some growth at 20C. Does not grow at 25C. Rescued by male mating.
|
|
| KK184 |
C. elegans |
par-4(it47) V. Show Description
Strict maternal effect lethal. Temperature sensitive-grow at 15C. Par at 20C and 25C.
|
|
| KK26 |
C. elegans |
unc-4(e120) ooc-3(b310)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4 which give dead eggs. Maintain by picking WT. Strict maternal effect.
|
|
| KK28 |
C. elegans |
unc-4(e120) mel-17(b299)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Strict maternal effect.
|
|
| KK288 |
C. elegans |
sqt-3(sc8) par-1(b274) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, RolPar (adult homozygotes lay eggs that don't hatch) and dead eggs. nT1[unc-?(n754) let-?] is dominant Unc and recessive lethal. Strict maternal effect. sc8 previously called rol-4(sc8).
|
|
| KK299 |
C. elegans |
par-5(it55) unc-22(e66) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, Twitchers which give only dead eggs, and dead eggs. nT1 heterozygotes are shorter and slower than par-5 unc-22 homozygous worms. par-5 region is not well balanced by nT1: check to make sure that unc-22 homozygotes lay dead eggs. Strict maternal effect lethal.
|
|
| KK337 |
C. elegans |
unc-4(e120) mex-1(it9)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4 which give dead eggs. Maintain by picking WT. Strict maternal effect. it9 was previously called mel-21(it9).
|
|
| KK338 |
C. elegans |
mel-10(it10) unc-4(e120) sqt-1(sc13)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Strict maternal effect.
|
|
| KK344 |
C. elegans |
unc-4(e120) mel-22(it30)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4 which give dead eggs. Maintain by picking WT. Strict maternal effect.
|
|
| KK352 |
C. elegans |
unc-4(e120) top-2(it38)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Not a strict maternal effect-rescued by male mating.
|
|
| KK356 |
C. elegans |
mel-4(it12) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs (it12 is temperature sensitive). Maintain by picking WT. Strict maternal effect.
|
|
| KK357 |
C. elegans |
mel-1(it19) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Strict maternal effect.
|
|
| KK359 |
C. elegans |
tofu-6(it20) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Strict maternal effect.
|
|
| KK36 |
C. elegans |
unc-4(e120) mel-13(b306) sqt-1(sc13)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, paralysed DpyUnc and RolUnc-4 which give dead eggs. Maintain by picking WT. Strict maternal effect.
|
|
| KK364 |
C. elegans |
mel-8(it27) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
mel-8 is a maternal effect lethal. WT heterozygotes segregate WT; mel-8 unc-4 homozygotes that lay eggs that don't hatch, and mnC1 dpy-10 unc-52 homozygotes (paralyzed Dpys). Some F2 mel homozygotes hatch, but such escapers arrest at L1 or L2. Previously called mel-6(it27).
|
|