Search Strains

aBoc and Exp defective. Slow growth and small brood size. tgDf1 deletes aex-1 and lrp-1.

Pvl. Egl. Weaker allele than pf88 and pf159.

Pvl. Egl. Poor mating.

uaDf5/+ is stable as a heterozygote. The strain does not appear to segregate live animals with uaDf5/uaDf5 or +/+ genotypes. Throws males.

Shortened lifespan.

DEET-resistant. ejd2 causes a F48V substitution in nstp-3. Reference: Dennis EJ, et al. Nature. 2018 Oct;562(7725):119-123.

DEET-resistant. ejd3 causes a P314S substitution in str-217. Reference: Dennis EJ, et al. Nature. 2018 Oct;562(7725):119-123.

DEET-resistant. ejd1 is a CRISPR/Cas9-induced mutation causing a predicted frame-shift in the first exon. WT (affected sequence between arrows): GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>CTGCTCCAAAAAAAAAA

Reduction in serotonin and dopamine, most apparent in young larva; bleach hypersensitivity and cuticle fragility in adult, but less than null mutants. Derived by outcrossing CB7107 six times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.

Slight reduction in serotonin and dopamine, most apparent in L1 larva. Derived by outcrossing FX5924 four times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.

General chemical hypersensitivity (including bleach), fragile cuticle. Derived by outcrossing CB7014 five times to N2. [NOTE: the e3016 mutation is TGG>TGA but it affects codon W124, not W130.] Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.

Serotonin-deficient by anti-serotonin straining. Likely also dopamine-deficient (but not tested).

Dpy Unc. Derived from DR103. Outcrossed 3 times.

Superficially WT. Cuticle slightly more resistant to insult than WT. ES1-ES0. Severe cuticle abnormalities in double mutant with bli-3(e767).

Serotonin- and dopamine-deficient, tetrahydrobiopterin-deficient, general chemical hypersensitivity, cuticle fragility (rapid disintegration in alkaline bleach), male turning defective (phenotypes appear identical to cat-4 null mutants). Derived by outcrossing FX1984 five times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.

Serotonin and dopamine-deficient, bleach hypersensitive, general chemical hypersensitivity, fragile cuticle. 652 bp deletion removes entire first exon. Derived by outcrossing FX773 five times to N2.

Propanagrolaimus sp. wild isolate. Can be maintained and frozen using C. elegans conditions. Reference: Schiffer PH, et al. Dev Genes Evol. 2014 Jun;224(3):183-8. doi: 10.1007/s00427-014-0471-2. PMID: 24849338.

Slight reduction in serotonin and dopamine, most apparent in L1 larva. Derived by outcrossing FX2337 two times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.

Slight reduction in serotonin and dopamine, most apparent in L1 larva. Derived by outcrossing FX2373 two times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.

ldIs7 [skn-1b/c::GFP + rol-6(su1006)]. Rollers. Reference: An JH and Blackwell TK. Genes Dev. 2003 Aug 1;17(15):1882-93.

ldEx9 [skn-1(operon)::GFP + rol-6(su1006)]. Maintain by picking Rollers. Reference: Tullet JM, et al. Cell. 2008 Mar 21;132(6):1025-38.

ldIs3 [gcs-1p::GFP + rol-6(su1006)]. Rollers. Reference: Wang J, et al. PLoS Genet. 2010 Aug 5;6(8). pii: e1001048.

ldEx1050 [pcst-1p::pcst-1::GFP +rol-6(su1006)]. Maintain by picking Rollers. Reference: Lehtinen MK, et al. Cell. 2006 Jun 2;125(5):987-1001.

Unc. Egl. lqIs3[osm-6::GFP].

lqIs3 [osm-6::GFP] IV. Unc. Egl.

24% PDE axon guidance errors, 28% ectopic axons. Reference: Lundquist et al. Development. 2001 Nov;128(22):4475-88.

Sick. Low brood size. Reference: Demarco RS, Lundquist EA. PLoS Genet. 2010 Nov 18;6(11):e1001215.

Sterile. Gonad & rachis defects. Grow at 20 C.

lqEx463 [rack-1::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Demarco RS, Lundquist EA. PLoS Genet. 2010 Nov 18;6(11):e1001215.

lqIs126 [rack-1::MYC + osm-6::GFP]. lqIs126 rescues sterility, gonadal distal tip cell migration defects, and axon pathfinding defects caused by rack-1(tm2262). Reference: Demarco RS, Lundquist EA. PLoS Genet. 2010 Nov 18;6(11):e1001215.

lqIs151 [scm::unc-40::GFP + str-1::GFP].

juIs76 [unc-25p::GFP + lin-15(+)] II. Unc. Reference: Norris AD & Lundquist EA. Development. 2011 Oct;138(20):4433-42.

Gonad & rachis defects. Grow at 20 C.

lqIs170 [F25B3.3p::vab-10(ABD)::GFP + ttx-3::RFP] X. Pan-neuronal GFP expression. Reference: Norris AD & Lundquist EA. Development. 2011 Oct;138(20):4433-42.

lqEx631 [tiam-1::CFP + str-1::GFP]. GFP expression in AWB amphid neurons. CFP neural expression in the head and tail, the ventral cord commissural motorneurons, the mechanosensory neurons (ALMs, PLMs, AVM, PVM) and the CAN, PDE, and PVD neurons. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.

lqIs2 [osm-6::GFP + lin-15(+)].

juIs76 [unc-25p::GFP + lin-15(+)] II. Unc. Reference: Norris AD & Lundquist EA. Development. 2011 Oct;138(20):4433-42.

lqIs3 [osm-6::GFP] IV.

juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs2 [osm-6::GFP] X. lqIs2 carries a PDE/amphid/phasmid marker linked to mig-2. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.

juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs3 [osm-6::GFP] IV. lqIs3 carries a PDE/amphid/phasmid marker linked to ced-10. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.

juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs2 [osm-6::GFP] X. lqIs2 carries a PDE/amphid/phasmid marker linked to mig-2. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.

juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs3 [osm-6::GFP] IV. lqIs3 carries a PDE/amphid/phasmid marker linked to ced-10. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.

lqIs10 [ceh-10::GFP + lin-15(+)]. lin-15(n765) mutation not confirmed after outcrossing.

lqIs250 [unc-5::GFP + gcy-32::CFP]. Reference: Norris AD, et al. Development. 2014 Nov;141(22):4395-405.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. lqIs58 [gcy-32::CFP] V. Reference: Josephson MP, et al. PLoS One. 2016 Feb 10;11(2):e0148658.

Dpy. AQR and PQR migration defects. Body wall muscle defects. etr-1(lq61) is a premature stop in alternatively-spliced exon 8. Reference: Ochs ME, et al. G3: Genes Genomes, Genetics. 2020 Jul 7;10(7):2365-2376. doi: 10.1534/g3.120.401182. PMID: 32398235

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. lqIs80 [SCMp::GFP::caax] IV. Rollers. GFP expression in seam cells. Red fluorescence in vulvae. YFP cannot be detected.

Dpy. AQR and PQR migration defects. Body wall muscle defects. etr-1(lq133) is 2 bp deletion frameshift in alternatively-spliced exon 8. Reference: Ochs ME, et al. G3: Genes Genomes, Genetics. 2020 Jul 7;10(7):2365-2376. doi: 10.1534/g3.120.401182. PMID: 32398235

lqIs294 [unc-25p::myr::unc-5 + gcy-32p::YFP]. VD/DD axon guidance defects. YFP expression in AQR, PQR and URXL/R. Reference: Norris AD, et al. Development. 2014 Nov;141(22):4395-405. doi: 10.1242/dev.110437. PMID: 25371370.

F53C11.8. Homozygous. Outer Left Sequence: AGGCGGAGAAAGTGACTTGA. Outer Right Sequence: CCCCTCACGCAGTGTTTTAT. Inner Left Sequence: TGAAGCAAATTGCAATCCAG. Inner Right Sequence: AACGAAATTGTGATCGGAGG. Inner Primer WT PCR Product: 2317. Deletion size: 1190 bp.