Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
JU441 C. briggsae C. briggsae wild isolate. Show Description
From Beauchêne (Eure & Loir -France), in the cabbage parcel, 12 Sep 03. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU516 C. briggsae C. briggsae wild isolate. Show Description
Isolated from compost heap in Marsas (Hautes-Pyrénées, France) on August 15, 2004. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU533 C. elegans C. elegans wild isolate. Show Description
Isolated from compost heap in Primel-Trégastel (Finistère, France), 03 Oct 04. Picked as adult on 6 Oct 04. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU561 C. elegans C. elegans wild isolate. Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU642 C. elegans C. elegans wild isolate. Show Description
Isolated from the compost heap in Jean-Antoine Lepesant's garden (Le Perreux sur Marne -94- France), 14 Dec 04. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU725 C. briggsae C. briggsae wild isolate. Show Description
Isolated on May 4, 2005 from mushroom compost in a farmyard 1 km south of Yangshuo, Guangxi, China. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU726 C. briggsae C. briggsae wild isolate. Show Description
Isolated on May 6, 2005 from soil with freshly added compost in a cabbage field in Chengyang Village, 20 km north of Sanjiang, Guangxi, China. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU751 C. elegans C. elegans wild isolate. Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU757 C. briggsae C. briggsae wild isolate. Show Description
Isolated in Le Blanc (12 June 2005), from a compost heap. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU774 C. elegans C. elegans wild isolate. Show Description
Isolated in Carcavelos, Portugal from garden garbage left on pavement, 10 July 05. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU775 C. elegans C. elegans wild isolate. Show Description
Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a tree with red fruits rotting. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU776 C. elegans C. elegans wild isolate. Show Description
Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a tree with red fruits rotting. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU777 C. elegans C. elegans wild isolate. Show Description
Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a tree with red fruits rotting. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU778 C. elegans C. elegans wild isolate. Show Description
Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a Ficus isophlebia tree with fruit. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU779 C. elegans C. elegans wild isolate. Show Description
Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a Ficus isophlebia tree with fruit. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU780 C. elegans C. elegans wild isolate. Show Description
Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a Ficus isophlebia tree with fruit. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU781 C. elegans C. elegans wild isolate. Show Description
Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a Ficus isophlebia tree with fruit. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU782 C. elegans C. elegans wild isolate. Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU792 C. elegans C. elegans wild isolate. Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU793 C. briggsae C. briggsae wild isolate. Show Description
Isolated from the compost heap at the top of the garden in Frechendets (Hautes Pyrénées), on August 31, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU799 C. elegans C. elegans wild isolate. Show Description
Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a tree with red fruits rotting. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU829 C. elegans C. elegans wild isolate. Show Description
Compost heap of Ray Hong in Tübingen, Germany, 28 Sep 05. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU830 C. elegans C. elegans wild isolate. Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU835 C. briggsae C. briggsae wild isolate. Show Description
Isolated from a vegetable garden/orchard near Obernai (Bas-Rhin), France on October 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU847 C. elegans C. elegans wild isolate. Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JU852 C. elegans C. elegans wild isolate. Show Description
Sampled in a compost heap in vegetable gardens/vineyards (Bas-Rhin), France on 3 Oct 05 by MAF. Plated 4 Oct, picked as L4 on 4 Oct 05. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
JW106 C. elegans sup-39(je5) II; syr-1(je11) ?. Show Description
Synthetic Roller after L4 stage (85% penetrance). je5 is dominant and je11 is recessive. See 1996 East Coast Worm Meeting Abstract #80.
KAB111 C. elegans louIs7. Show Description
louIs7 [ges-1p::sqst-1::mCherry::GFP::unc-54 3'UTR]. Tandemly-tagged p62/sequestosome marker expressed in the gut can be used to monitor autophagic activity. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.
KAB157 C. elegans louIs10. Show Description
louIs10 [myo-3p::sqst-1::mCherry::GFP::unc-54 3'UTR]. Tandemly-tagged p62/sequestosome marker expressed in the muscle can be used to monitor autophagic activity. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.
KB10 C. elegans mir-67(n4899) III. Show Description
MT15982 mir-67(n4899) was outcrossed 6x to produce this strain. Deletion breakpoints are:GGGTGCCTAATGCAAA / AGTACACATTTATGAAT...GCGAGTTTAAAGCAACG / AGTAGCAGAAGGACCA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
KB11 C. elegans mir-83(n4638) IV. Show Description
MT15501 mir-83(n4638) was outcrossed 6x to produce this strain. Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
KG1180 C. elegans lite-1(ce314) X. Show Description
Defective response to short wavelength light; response strongly reduced but not eliminated. All other characteristics seem wild type, including reponse to mechanosensory stimuli. Strong, probably null, allele. This mutation also blocks the coordinated light response of unc-31(e928) and egl-30(ad805). To identify lite-1 homozygous mutants when crossing into different backgrounds, use a fluorescence stereomicroscope with a GFP filter and zoom to the hightest magnification (60-100X) to distinguish Lite from non-Lite animals. This works best when the animals are mired in thicker parts of the food to slow their spontaneous locomotion but not their response to light. Scan animals around the edge of the food where it is thickest. Leave the lid of the plate off for a minute or so before starting to let the animals adjust to air currents.
KG421 C. elegans gsa-1(ce81) I. Show Description
Coordinated hyperactive locomotion. Hypersensitive to mechanical stimuli. Most mature adults have vulval bump. Mature animals are slightly short and egl-d. Terminal phenotype is usually bag of worms. Population tends to severely crash within 2-3 weeks of starvation. Dominant, gain-of-function allele. Heterozygotes are difficult to distinguish from homozygotes. Mutation is R182C. This same mutation causes constitutive Gs activity in vertebrates. Sequence in WT: CCT TCG GTG TCG. Sequence in ce81: CCT TCG GTG TTG.
KG4386 C. elegans unc-104(ce782) II. Show Description
Temperature sensitive. Maintain at 15C. Animals grown at 14C take 23% longer than wild-type to reach adulthood, exhibit 0% larval arrest, locomotion rates that are ~40% of wild type, and synaptic vesicle densities at synapses that are ~60% of wild type. Animals grown at 20C take 80% longer than wild type to reach adulthood, exhibit locomotion rates that are ~3% of wild type, and synaptic vesicle densities at synapses that are ~2% of wild type. Animals grown at 25C exhibit >90% larval arrest. When shifting late larval stage and adult animals from 14C to 25C, it takes 8-12 hours to see effects on locomotion and SV density. Reference: Edwards SL, et el. Genetics. 2015 Sept 201(1): 91-116.
KG4731 C. elegans unc-116(ce815[LoxP+sup-1(e995)+LoxP]) III. Show Description
Lox P sites in 3' UTR and 4th intron flank kinesin motor domain sequences; sup-1(e995) mini-gene inserted in second intron. Appears wild-type on plates and in quantitative locomotion assays. Can be used to conditionally delete gene sequences encoding the conventional kinesin motor domain in a tissue specific manner by driving expression of Cre recombinase in the tissue of interest. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.
KG5148 C. elegans unc-104(ce833[5xMyc::AID*::unc-104+sup-1(e995)]) II. Show Description
The Auxin Inducible Degron (AID*) flanked by a 5X Myc/spacer tag on left and a single spacer on the right is fused to the N-terminus of the unc-104 gene. Allows conditional degradation of UNC-104 protein when combined with tissue specific expression of TIR1 in the presence of 1 mM Auxin in plate media. Note: KG5148 does not express TIR1. On standard plates: wild type growth, appearance, and locomotion rate. For animals expressing a TIR1 transgene in the nervous system: Animals that hatch and develop on 1 mM Auxin plates generally remain tightly coiled near the location of hatching and exhibit slow growth (up to 7 days to reach adulthood, with 98% reaching adulthood by 7 days). Adults placed on Auxin abruptly lose about 75% of their locomotion function between 6 and 12 hours after plating. The remaining locomotion function is lost gradually between 12 and 52 hours. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.
KG518 C. elegans acy-1(ce2) III. Show Description
About normal size and distribution on food. Hyperactive locomotion. Hypersensitive to stimuli. Most mature adults have slight vulval bump. Not obviously Egl-d or Egl-c. Dominant, gain-of-function allele. Mutation is P260S. Sequence in WT: CAGTCTGTGATG C CT. Sequence in ce2: CAGTCTGTGATG T CT.
KG522 C. elegans acy-1(md1756) III. Show Description
About normal size. Hyperactive locomotion. Hypersensitive to stimuli. Most mature adults have slight vulval bump. Not obviously Egl-d or Egl-c. Dominant, gain-of-function allele. Mutation is A337T. Sequence in WT: TAAATCT G CCGACG. Sequence in md1756: TAAATCT A CCGACG.
KG524 C. elegans gsa-1(ce94) I. Show Description
Short. Relatively constant motion (coordinated hyperactivity). Adults quickly become Egl-d and most have vulval bump. Hypersensitive to stimuli. Loopy backing, but does not like to back, especially after repeated stimuli. Terminal phenotype is usually bag of worms. Population tends to severely crash after 2-3 weeks of starvation. Dominant, gain-of-function allele. Heterozygotes are also hyperactive and difficult to tell apart from homozygotes. Mutation is G45R. Sequence in WT: GGC GCC G GA GAG AGC. Sequence in ce94: GGC GCC A GA GAG AGC.
KG532 C. elegans kin-2(ce179) X. Show Description
Adults generally short, although some can reach near normal length. Slow growth rate. Backing can be loopy, but does not like to back. Strongly hypersensitive to stimuli. Relatively constant spontaneous movement. Some clustering especially in response to stimuli. Mature adults have vulval bump. Most young adults are Egl-c and young embryos can be found on the plate. Some mature adults become moderately Egl-d. Recessive allele. Males are small and slow growing. Mutation is R92C, which is a conserved residue in the 10 amino acid inhibitory domain that normally functions to keep protein kinase A turned off in the absence of cAMP. Population tends to severely crash within 2-3 weeks of starvation.
KG744 C. elegans pde-4(ce268) II. Show Description
Hyperactive locomotion and hypersensitive to stimuli such as plate dropping. Restores wild type levels of locomotion to paralyzed ric-8(md303) mutants. Most, but not all adults, appear significantly Egl-c. Some mature adults are thinner than normal. Aldicarb sensitivity, growth rate, pumping, length, and distribution on food are all similar to wild type. The ce268 mutation is a D448N change relative to PDE-4D isoform. It disrupts the catalytic domain by changing one of the four active site residues that together chelate an active site zinc atom. Inheritance is semi-dominant due to dominant negative side effects.
KK241 C. elegans lon-1(e185) par-3(it62) III; sDp3 (III;f). Show Description
Animals with the Duplication are WT. Animals which have lost the Duplication are Lon and throw dead eggs.
KK364 C. elegans mel-8(it27) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
mel-8 is a maternal effect lethal. WT heterozygotes segregate WT; mel-8 unc-4 homozygotes that lay eggs that don't hatch, and mnC1 dpy-10 unc-52 homozygotes (paralyzed Dpys). Some F2 mel homozygotes hatch, but such escapers arrest at L1 or L2. Previously called mel-6(it27).
KM48 C. elegans +/szT1 [lon-2(e678)] I; cdk-4(gv3)/szT1 X. Show Description
745 bp deletion of cdk-4 from intron I to exon3 removing putative ATP binding domain and catalytic residues. Most homozygous animals arrest at L2 due to absence of most or all postembryonic somatic cell divisions. Some germline proliferation resulting in slightly elongated gonad.
KN611 C. elegans axl-1(tm1095) I. Show Description
tm1095 enhances Q neuroblast migration and vulva induction phenotype of pry-1. Minor defect in excretory cell development. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48.
KP1182 C. elegans acy-1(nu329) III. Show Description
No obvious phenotype on its own. Suppresses cell swelling and death caused by expression of a GTPase defective Gxs subunit expressed from the glr-1 promoter, semi-dominant. Strongest allele.
KR1233 C. elegans hDf8/dpy-5(e61) unc-13(e450) I. Show Description
Slow-growing wild-type, Him. Segregates WT, DpyUnc, WT males and dead eggs (hDf8 homozygotes). Heterozygotes also exhibit low-penetrance vulval blips; these may be more pronounced, present at higher frequency and accompanied at times by tail blips upon recovery from starvation. hDf8 dominantly suppresses recombination from around unc-13 at least to dpy-5, and possibly to the left end of chromosome I. Maintain by picking WT and checking for correct segregation of progeny. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR1279 C. elegans dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp19 (I;f). Show Description
Dup carrying animals are Dpy-14. Animals which have lost the Dup are DpyDpy-> these are very short and very fat in the middle. Maintain by picking the Dpy animals that move well. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR1280 C. elegans dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp13 (I;f). Show Description
Dup carrying animals are Dpy-14. Animals which have lost the Dup are DpyDpy-> these are very short and very fat in the middle. Maintain by picking the Dpy animals that move well. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR1282 C. elegans dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp16 (I;f). Show Description
Dup carrying animals are Dpy-14. Animals which have lost the Dup are DpyDpy-> these are very short and very fat in the middle. Maintain by picking the Dpy animals that move well. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.