Search Strains

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are Lethal DpyUnc.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as Sterile adults.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in mid larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early/mid larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication arrest in embyronic development.

Animals with the Dup are Unc. Animals which have lost the Dup are DpyUncLet and arrest in early larval development. Maintain by picking Unc.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in late larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in late larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are Dpy Unc and arrest in early mid development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in egg/early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in late larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in egg/early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are Dpy Unc and arrest in early mid development.

Unc. Maintain at 15C. Temperature-sensitive Emb when L4 larvae are shifted to restrictive temperature (25C). L1 larvae shifted to restrictive temperature arrest and die as young larvae. Reference: Bowman EA, et al. Worm Breeder's Gazette 2011 18(4).

Unc. Maintain at 15C. Temperature-sensitive Emb when L4 larvae are shifted to restrictive temperature (25C). L1 larvae shifted to restrictive temperature arrest and die as young larvae. Reference: Bowman EA, et al. Worm Breeder's Gazette 2011 18(4).

Segregates WT green-glowing heterozygotes and non-glowing cdk-9 homozygotes (arrest as L1-L2 larvae). qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).

ckSi12 [cdk-9(D235N)::mCherry + unc-119(+)] II. Segregates WT green-glowing heterozygotes and non-glowing cdk-9 homozygotes (arrest as L1-L2 larvae). qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).

ckSi21 [cdk-9::mCherry::pal-1 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. hT2 segregates WT green-glowing heterozygotes and non-GFP cdk-9 homozygotes (normally arrest as L1-L2 larvae; cdk-9 homozygotes carrying ckSi21 (GFP- mCherry+) are viable but sterile. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).

qIs26 [lag-2::GFP + rol-6(su1006)]. ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Throws heterozygous Rollers, tm3846 homozygotes (Emb), and tm3846 homozygotes (arrest as L1-L2 larvae). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. qIs26 is an integration of qEx233. Reference: Bowman EA, et al. Development. (In Press).

Heterozygotes are WT and GFP+. ok1211 homozygotes arrest at L2 stage. mIn1 animals are Dpy and GFP+.

Heterozygotes are WT and segregate WT, Paralyzed Uncs and L3 lethals. ua1 is a deletion of the first 3 full exons of the NADH-ubiquinone oxidoreductase of complex I in the mitochondrial respiratory chain.

Animals with the duplication are WT. Animals which have lost the duplication arrest at 3rd larval stage with increased life span. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.

Heterozygotes are WT and segregate WT, Dpy(ts) Steriles and Uncs which arrest in the L3 larval stage. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.

uaEx25 [(p016bA352V) nuo-1(+) + unc-119(+)]. Contains extrachromosomal nuo-1(A352V) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of the transgene. Low brood size. Short life span. Sensitive to oxidative stress.

uaIs26 [(p016bT434M) nuo-1(+) + unc-119(+)]. Carries integration of nuo-1(T434M) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of transgene. Site of integration unknown. Moderate brood size. Shorter life span. Sensitive to oxidative stress.

uaEx27 [(p016bA443F) nuo-1(+) + unc-119(+)]. Contains an extrachromosomal array carrying nuo-1(A443F) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of transgene. Low brood size. Short life span. Sensitive to oxidative stress.

DEET-resistant. ejd1 is a CRISPR/Cas9-induced mutation causing a predicted frame-shift in the first exon. WT (affected sequence between arrows): GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>CTGCTCCAAAAAAAAAA

Reduction in serotonin and dopamine, most apparent in young larva; bleach hypersensitivity and cuticle fragility in adult, but less than null mutants. Derived by outcrossing CB7107 six times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.

Slight reduction in serotonin and dopamine, most apparent in L1 larva. Derived by outcrossing FX5924 four times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.

Serotonin and dopamine-deficient, bleach hypersensitive, general chemical hypersensitivity, fragile cuticle. 652 bp deletion removes entire first exon. Derived by outcrossing FX773 five times to N2.

Slight reduction in serotonin and dopamine, most apparent in L1 larva. Derived by outcrossing FX2337 two times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.

Slight reduction in serotonin and dopamine, most apparent in L1 larva. Derived by outcrossing FX2373 two times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.

ldEx1050 [pcst-1p::pcst-1::GFP +rol-6(su1006)]. Maintain by picking Rollers. Reference: Lehtinen MK, et al. Cell. 2006 Jun 2;125(5):987-1001.

lqIs3 [osm-6::GFP] IV. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011 (Submitted).

lqIs2 [osm-6::GFP + lin-15(+)]. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.

24% PDE axon guidance errors, 28% ectopic axons. Reference: Lundquist et al. Development. 2001 Nov;128(22):4475-88.

Sick. Low brood size. Reference: Demarco RS, Lundquist EA. PLoS Genet. 2010 Nov 18;6(11):e1001215.

lqEx463 [rack-1::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Demarco RS, Lundquist EA. PLoS Genet. 2010 Nov 18;6(11):e1001215.

lqIs126 [rack-1::MYC + osm-6::GFP]. lqIs126 rescues sterility, gonadal distal tip cell migration defects, and axon pathfinding defects caused by rack-1(tm2262). Reference: Demarco RS, Lundquist EA. PLoS Genet. 2010 Nov 18;6(11):e1001215.

lqIs128 [unc-25p::MYR::unc-40(constitutively active)::GFP + unc-25p::GFP]. Contains a myristylated, constitutively-active form of UNC-40. Slightly Unc. Reference: Norris AD & Lundquist EA. Development. 2011 Oct;138(20):4433-42.

lqIs2 [osm-6::GFP + lin-15(+)]. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.

lqIs3 [osm-6::GFP] IV. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.