Search Strains

ZK550.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3391 homozygotes (sterile, lays no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACCGATAAGGGACTCGAAA. External right primer: CTCATCCACCACTTGGGTCT. Internal left primer: TTTCCTGTCGGAAAATTCAGTT. Internal right primer: CGACATTTCCATTTCATCTTGA. Internal WT amplicon: 1542 bp. Deletion size: 386 bp. Deletion left flank: TCATCAGAATTTTGATAAATACTTTTAAAA. Deletion right flank: TTTAATTTTTTTTAAAGAAAAATATTCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26D10.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1371 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCTCTCTCCCCCTTTTCGT. External right primer: AATAGCTTCTGCACCGCCTA. Internal left primer: GTTTTCATGCACGGAAAGGT. Internal right primer: CCTCAACCCCTGGCATAATA. Internal WT amplicon: 2566 bp. Deletion size: 1225 bp. Deletion left flank: ACGCAACGTTCTTATCTTCGATCTTGGAGG. Deletion right flank: CCTTCAACCTTAAGCAGACCATTGAGGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02B10.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3390 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAATCCACAGAACCG. External right primer: TTGCGGTAGCTTAGGCAGAT. Internal left primer: CCTGAGTCATCTCCTGCACA. Internal right primer: AGAGCGGGATCTGGAAAAAT. Internal WT amplicon: 2056 bp. Deletion size: 775 bp. Deletion left flank: CGGCGGAGCAAGAGTATTATTATTTCACGT. Deletion right flank: GCTGGAGATGATGGCGAATTCTTCGAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

aph-2. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2950 homozygotes (arrest stage not determined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGAAGTGGAGATAGGTGGG. External right primer: TGTTTCAGAACAGCGACCTG. Internal left primer: ATTCCGAGTGTCGTTTTTCG. Internal right primer: CCATTTAAAGGCGCAAACAT. Internal WT amplicon: 1456 bp. Deletion size: 426 bp. Left flanking sequence: AAAGAAACATTGAATGTGAAAAGTGAAAAG. Right flanking sequence: GAGTTTCGCATTAAAGAAAACTAGATTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02B9. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C43E11.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1368 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAGAACGTGTACCCGAAGGT. External right primer: TTCCCGATGCTTCACTTTCT. Internal left primer: AGAGAACGCGTTGAAAGGAA. Internal right primer: TTCACCCCTTTCGTGGATAG. Internal WT amplicon: 2704 bp. Deletion size: 1290 bp. Deletion left flank: TGATAGCCGATTTTGCCGTCGGAGCATCAA. Deletion right flank: TAATTTCTTCGCTGTCAGATTCCGATGAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25H5.1c. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W07B3.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3388 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGATAATCATGCCAGAAGTG. External right primer: ATCGAGCAGAATTTGTCCATTT. Internal left primer: ACACCTGAATCTGCTGCTGTT. Internal right primer: ACGAATTGAATGAAATCACGC. Internal WT amplicon: 2021 bp. Deletion size: 296 bp. Deletion left flank: ATCCAGTGCTTCTCCGTTGATACGGCCTAT. Deletion right flank: CAAGTTTGGTATGGTAAATATTTAGCAGAC. Insertion Sequence: GTTTGGTATGGTAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26E4.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25F8.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W08E3.1. Heterozygotes are WT and segregate WT, Unc hIn1 homozygotes and gk209 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T09A5.3. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok605 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK757.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46C5.3. External left primer: GGATCATGCTCATCTCCGAT. External right primer: CGGTTTCTTGCTTCATCCTC. Internal left primer: GACGCCAACAAATTGGAACT. Internal right primer: ATTTGAAACAAAGAAGGCGG. Internal WT amplicon: 1158 bp. Deletion size: 651 bp. Deletion left flank: AAGTGTTATGCATTATTCAGCTGATTCGTA. Deletion right flank: CTCCATTAAATCTAACAACTACTGTTAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07G5.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3542 homozygotes (sterile, lays some eggs but none hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGCCTTTTGTAGATGTGATAGGA. External right primer: TAATCCGAAAGTCACAAAATCTGA. Internal left primer: GTCCCCACAGATGACGTTCT. Internal right primer: CCTTGCATCAGCTTTTCACA. Internal WT amplicon: 1884 bp. Deletion size: approximately 1125 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28C12.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59A2.4. Deletion balanced by glp-1 and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3753 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAACACCAATGGATTTGGC. External right primer: CCAGGCTTGCAAATAAGCTC. Internal left primer: AAAGTCAATTTCGGCCCATT. Internal right primer: TTGAGGACAAAACCTACCCG. Internal WT amplicon: 1279 bp. Deletion size: 698 bp. Deletion left flank: CCGAGAGCGCATACGTTGCCGAGAGCACTC. Deletion right flank: AAATCTATCTCTCTACGAAGCATTGTTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22A3.8. Homozygous lethal deletion balanced with bli-4-marked balancer. Heterozygotes are WT and segregate WT, Bli-4 hT2 homozygotes, hT2 aneuploids (arrested embryos), and ok2030 homozygotes (arrest stage/phenotype undetermined). hT2 homozygotes do not blister until the adult, and may be very difficult to tell from WT. Pick WT and check for correct segregation of progeny to maintain. External left primer: GGAGGTCGTAGATGCGAGAG. External right primer: TTCTCAACTCCGATCGCTTT. Internal left primer: TATCGGCTTCCAATCCTTTG. Internal right primer: GCTTTCGGGTAAGTGTGAGC. Internal WT amplicon: 3097 bp. Deletion size: 1499 bp. Deletion left flank: GTAAACCAGGACACGTCGGAAATCCATCTC. Deletion right flank: TGGTTCCAATATGAACCGAAAAATTTACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs53 [Pharyngeal GFP marker] III. F10C5.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT dim GFP (heterozygotes), WT bright GFP (okIs53 homozygotes) and gk197 homozygotes (sterile, mildly Unc). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK370.2. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3109 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTCGCTGATTCCAGTCGTTT. External right primer: AGCTAAATCCGCACACGAAC. Internal left primer: TAAACAGCATGCGGTGGAAT. Internal right primer: TGAAAAATTTGGCTCCGAGT. Internal WT amplicon: 1222 bp. Deletion size: 707 bp. Deletion left flank: AATAACTTTGAGAGGGAAAAGGTTACGAAA. Deletion right flank: TCACTGAAGATTTTCGATATGGAGATTTTT. Insertion sequence: TCACTGAAGATTTTCGATATGTATTTGAGAGGGAAAAGGTTACGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T19B4.2. Heterozygotes are WT, and segregate WT, arrested hT2 aneuploid progeny, Bli hT2 homozygotes, and homozygous ok601 hermaphrodites (arrest stage/phenotype undetermined). The bli-4 mutation does not express until the adult, and is sometimes extremely subtle. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42G8.3. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk21 hermaphrodites (L1 arrest). gk21 appears to be linked to an uncharacterized unc-5 lesion: complementation tests with unc-5/+; dpy-11/+ males produced viable Unc-5 male and hermaphrodite progeny. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK930.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Morphological markers unc-5 and dpy-11 balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested nT1 aneuploid progeny, and GFP- unc-5; dpy-11 homozygotes. nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 7 bp. Left flanking sequence: AGCCTTCTGCTGACTAATAACTTTCCATTT; Right flanking sequence: GCGGACTTGCACTGGAAATTTTAATTTCTT. See WormBase Variation gk3858 for details.

Homozygous viable. Deletion of 72 bp with AAAAAAAAAA inserted at break. Left flanking sequence: GGCTATAAGAAGTTGGAGTGCATAAATGAC; Right flanking sequence: TTTTGATCTCAGTTATTACATTAATCAAGG. See WormBase Variation gk3859 for details.

B0495.4. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok553 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3614 homozygotes (mid- to late-larval arrest, thin and slightly uncoordinated, sometimes with protruding vulval tissue). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

K01G5.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38E1.7, F38E1.9. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok591 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T14G10.6 . Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 900 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATTGTTCTGTGTTTGCTACCCGGTTAAA; Right flanking sequence: AAACAAGTCAAAAGAACAATTTGTCAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F54C9.8. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- ok464 homozygotes (probable embryonic arrest). Some heterozygotes appear to be sterile and even those with eggs seem to grow a bit slowly. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45B8.4. Unc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 325 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AACTGGAAATGTGTGCTTTATTCAGCCATC; Right flanking sequence: AGAAGCCGAAAAAATCAAGTAAATATATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 490 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GGTATACGCGAAAATTACACACATTACAGT; Right flanking sequence: AAGCATTTAAAAAGTTTTTGTATTCTGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

T28F2.5. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, and homozygous gk18 hermaphrodites (lumpy 2-fold arrest). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R05D3.4. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok572 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 850 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CCCCGTAATAATCCCTGTTTTTTCCAGCAG; Right flanking sequence: TCATCATCATCTTCCTCCCACTGGTCTGGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Primary deletion of 720 bp in pry-1 with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAGGGGCCCCTCCCGGTAGCCGGTCGAGCG; Right flanking sequence: GGATTTTTCTGCGAAATTTGGATTTAGCTT. Strain carries secondary 5-bp deletion in F56E10.1, with flanking sequences GGCGCCGGCGGTGAAGAGGATGAGGACAAT and GGATTCAGAAGAAGAAGATGAAGAAGACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 370 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTGTGTGTATGTATGTAGATCAGTGTTCC; Right flanking sequence: CGGAAAGTCTAATCTATTGCTGCGATTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1240 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTTTTAGAAAAATCGATCAGCCACGAAAAA; Right flanking sequence: ACCACTGCCGTCTTCGTGAACCGCATCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

okIs59 [myo-2::GFP + pes-10::GFP + F22B7.9::GFP] I. T09B4.10, T09B4.2. Heterozygote has wild-type gross phenotype, with semi-dominant GFP expression in pharynx. Segregates WT dim GFP, WT bright GFP (okIs59 homozygotes) and ok459 homozygotes (arrest stage/phenotype undetermined). Pick dim GFP WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 57 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATCCTTCTGAAACATCGATTCAGTGGAG. Right flanking sequence: AGGTTTGCGCACACTAATTATCGATTTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 569 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAAATCGACCAATTCCTCGAATGGGAATCT; Right flanking sequence: CGGATCCAAGAAGGATATGAGAGTCAAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 713 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GATCTGGAAAAATTTGTTTTTTCGTAGATA; Right flanking sequence: AGGTGATGCAGCAGACAGATGTCACACTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 284 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATGCGATTGCTGCTTCATTTGTTATTCG; Right flanking sequence: TGGAAGCCATGCCAAGGTGAGTGGAAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 536 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTAGTTCTTTAAATGACTACTGTAGTGT; Right flanking sequence: TGGTAACTAATCTCAAATAGATTTTAAATT. See WormBase Variation gk3695 for details.

Homozygous viable. Deletion of 1047 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTATTTGGACAACGCTCTGTGCACAAATCA; Right flanking sequence: TGGCTTAACGAATGAAGATAATGGATTCAA. See WormBase Variation gk3700 for details.

Homozygous viable. Deletion of 956 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGCATCTTCAGCTAGCAGCTTCTTCGGAGG. Right flanking sequence: CGGATGCATTCAATGACAAGCAGATTTACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.