More Fields
Strain Species Genotype
EW35 C. elegans sem-4(ga82) I. Show Description
GLW35 C. elegans T13C2.6(utx27[mNG::3xFlag::T13C2.6]) II. Show Description
N-terminal tag of T13C2.6 via CRISPR/Cas9 knock-in of mNeonGreen at T13C2.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' aaatattaattgataatcagaggagtaaaa 3'; Right flank: 5' ATGAGGACATGTCTCACCCTCACGGGTTTC 3'; sgRNA: taatcagaggagtaaaaATG; Cas9/sgRNA plasmid: pGLOW45; mNG^SEC^3xFlag plasmid: pGLOW54; SEC insertion allele strain: GLW34.
SU62 C. elegans unc-44(e1260) lag-1(q385)/zen-4(w35) IV. Show Description
Heterozygotes are WT and segregate WT, Unc L1 lethals and dead eggs (homozygous zen-4(w35)).
RW3518 C. elegans pat-11(st541)/dpy-5(e61) I. Show Description
Heterozygotes are WT and segregate WT, Dpys and embryos which arrest at the 2-fold stage.
RW3534 C. elegans lev-11(st536)/unc-54(e1213) I. Show Description
Heterozygotes are WT and segregate WT, Pats and Uncs. Not well balanced.
RW3538 C. elegans myo-3(st386)/sqt-3(e24) V. Show Description
Heterozygotes are WT. Segregates WT, Sqt and Dead embryos (2-fold arrest). myo-3 Null. Maintain by picking WT.
RW3539 C. elegans emb-9(st545)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs.
RW3550 C. elegans pat-4(st551)/unc-45(e286) III. Show Description
Heterozygotes are WT and segregate WT, Uncs (at 20C and 25C) and Pats. Maintain by picking WT at or above 20C. See also WBPaper00005261.
RW3562 C. elegans unc-44(e362) deb-1(st555)/unc-82(e1323) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs (unc-82 unc-24 homozygotes) and dead eggs (unc-44 deb-1 homozygotes).
RW3563 C. elegans egl-19(st556)/unc-82(e1323) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs, and Pats. Maintain by picking WT and checking for correct segregation of progeny. st556 pka pat-5.
RW3566 C. elegans lev-11(st557)/unc-54(e1213) I. Show Description
Heterozygotes are WT and segregate WT, Pats and Uncs. st557 is antibody negative.
RW3568 C. elegans pat-6(st561)/dpy-9(e12) IV. Show Description
Heterozygotes are WT and segregate WT, Dpys and Pats. Maintain by picking WT and checking for correct segregation of progeny.
RW3570 C. elegans unc-112(st562)/dpy-11(e224) unc-23(e25) V. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Pats. Maintain by picking WT and checking for correction segregation of progeny.