Egl.

N-terminal tag of T13C2.6 via CRISPR/Cas9 knock-in of mNeonGreen at T13C2.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' aaatattaattgataatcagaggagtaaaa 3'; Right flank: 5' ATGAGGACATGTCTCACCCTCACGGGTTTC 3'; sgRNA: taatcagaggagtaaaaATG; Cas9/sgRNA plasmid: pGLOW45; mNG^SEC^3xFlag plasmid: pGLOW54; SEC insertion allele strain: GLW34.

Heterozygotes are WT and segregate WT, Unc L1 lethals and dead eggs (homozygous zen-4(w35)).

Heterozygotes are WT and segregate WT, Dpys and embryos which arrest at the 2-fold stage.

Heterozygotes are WT and segregate WT, Pats and Uncs. Not well balanced.

Heterozygotes are WT. Segregates WT, Sqt and Dead embryos (2-fold arrest). myo-3 Null. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs.

Heterozygotes are WT and segregate WT, Uncs (at 20C and 25C) and Pats. Maintain by picking WT at or above 20C. See also WBPaper00005261.

Heterozygotes are WT and segregate WT, Uncs (unc-82 unc-24 homozygotes) and dead eggs (unc-44 deb-1 homozygotes).

Heterozygotes are WT and segregate WT, Uncs, and Pats. Maintain by picking WT and checking for correct segregation of progeny. st556 pka pat-5.

Heterozygotes are WT and segregate WT, Pats and Uncs. st557 is antibody negative.

Heterozygotes are WT and segregate WT, Dpys and Pats. Maintain by picking WT and checking for correct segregation of progeny.

Heterozygotes are WT and segregate WT, DpyUnc and Pats. Maintain by picking WT and checking for correction segregation of progeny.