Search Strains

muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. Many animals roll weakly or not at all, but still express GFP. Grows at all temperatures.

muIs105 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Rollers; Rol phenotype is not always evident). Integrated line derived from CF1449. Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.

Temperature sensitive. Sterile at 25C. Maintain at 15C. [NOTE: CF1903 carries glp-1(e2144), not e2141 as previously described.]

muIs27 [mig-2::GFP + dpy-20(+)]. Him. non-Dpy. GFP is membrane enriched and expressed in many cells throughout development (see reference for details). Not known in which LG muIs27 is integrated.

muIs28 [mig-2::GFP + unc-31(+)]. muIs28 is not mapped, but probably on LG II by process of elimination.

umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, dcr-1 homozygotes (protruding vulva, sterile/egl, rupture at vulva), lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Pvul. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived from parental strains CGC26 and NL687. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

umnIs42 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate2+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

umnIs67 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

dvIs70 [hsp-16.2p::GFP + rol-6(su1006)]. Roller. Integrated array containg pCL25 (hsp-16-2 promoter/GFP transcriptional fusion) and pRF4. Shows robust induction of GFP expression after heat induction. Not known where dvIs70 is integrated.

dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by "chunking", which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

F52B11.6. Superficially wild-type. knu572 is an F125L point mutation mimicking human mutation F119L in patients with PMM2 deficiency disease. Strain is sensitive to bortezomib (proteasome blocker) and displays larval arrest in liquid culture. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.

Hyperactive, protruding vulva. knu751 is an A221D point mutation associated with GNAO1-associated epileptic encephalopathy. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.

Superficially wild-type. knu796 is a K216E point mutation mimicking a patient allele associated with Coffin-Lowry syndrome. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.

knu858 is a Y146C point mutation representative of a patient mutation associated with MPSIIIB disease. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.

Superficially wild-type. knu860 is a W1044X point mutation associated with Cori Disease. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.

Superficially wild-type. knu864 is a S1444R point mutation associated with Cori Disease. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.

Superficially wild-type. knu867 is a 6955 bp deletion in agl-1. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.services/. For more information, please contact ethan@perlara.com

knu869 is a 4077 bp deletion in sul-1. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.services/. For more information, please contact ethan@perlara.com

mCherry tag inserted at the C-terminus of the endogenous spin-1 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

mCherry tag inserted at the C-terminus of the endogenous spin-2 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

mCherry tag inserted at the C-terminus of the endogenous spin-3 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

mCherry tag inserted at the C-terminus of the endogenous spin-4 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

knu1099 is an engineered 7437 bp deletion in spin-4. Flanking sequences immediately outside of the region deleted ares: 5′ flank (forward strand), 5′- GTT CGG TGG AGC GCG CCT GCG -3’; 3′ flank (reverse strand), 5′- GTC TGT GTT GCT GTT CCT CAT -3’. In between these flanking sequences, a three-frame stop as well as a unique primer-binding sequence were inserted in place of the deleted sequence. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Flora Y & Bohnert KA. Dev Biol. 2023 Dec:504:137-148. doi: 10.1016/j.ydbio.2023.09.013. PMID: 37805103.

knu1284 is a CRISPR-engineered in-frame deletion of the TZF domain of oma-1. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. When OMA-2 is present, this mutant does not appear to have obvious phenotypes. Auxin-inducible depletion of OMA-2 causes a null phenotype: animals do not produce mature embryos and have an empty uterus. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.

Cholesterol-sensitive. Smaller broods and sizes upon serial cholesterol deprivation. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.

Larval-lethal puf-2 deletion allele. Heterozygotes are WT (slightly Dpy) and segregate 25% Dpy, 50% wild-type heterozygotes, and 25% larval lethal (arrest L1-L2). Maintain by picking WT and checking for correct segregation of progeny. Map distance between nm4 and nm66 has not been preciely determined, but is tight enough that >90% of non-Dpy non-Lva progeny from double-heterozygotes retain the parental genotype. Reference: Liu Q & Haag ES. J Exp Zool. 2013 Part B.

nmIs7 [Cni-mss-1(+) + Cni-mss-2(+) + Cbr-myo-2::GFP + unc-119(+)]. Insertion site of transgene is not known, but it is not in LG III or X. Males with this transgene are more competitive in siring progeny; also a higher ratio of males in the population. Derived from parental strain CP99, which in turn was derived from AF16. Reference: Yin D, et al. Science. 2018 Jan 5;359(6371):55-61.

When singled, hermaphrodites should throw 2/3 hermaphrodites and 1/2 nm2 XX males. The lethal appears to balance the nm2 allele pretty well, but precise recombination mapping has not been performed. The XX males maintain their phenotypic resemblance to the unbalanced strain and are probably not fertile due to obvious gonadal deficiencies. This strain has been successfully grown at 15C and 20C. Both strains appear to have complete penetrance of the mutant phenotypes.

zaEx5 [let-7::GFP + rol-6(su1006)]. Pick GFP+ to maintain. The GFP+ animals may not always express the Roller phenotype.

zaEx16 [mir-84::GFP + rol-6(su1006)]. Pick GFP+ to maintain. The GFP+ animals may not always express the Roller phenotype.

zaEx17 [lin-4::GFP + rol-6(su1006)]. Pick GFP+ to maintain. The GFP+ animals may not always express the Roller phenotype.

zaEx18 [mir-237::GFP + rol-6(su1006)]. Pick GFP+ to maintain. The GFP+ animals may not always express the Roller phenotype.

zaEx19 [mir-48::GFP + rol-6(su1006)]. Pick GFP+ to maintain. The GFP+ animals may not always express the Roller phenotype.

zaIs5 [alg-1p::GFP::alg-1 + rol-6(su1006)]. Some GFP+ animals do not roll. GFP::ALG-1 expression throughout development, detectable as punctate cytoplasmic granules. Maintain by picking rollers. Reference: Chan SP, Slack FJ. Dev Biol. 2009 Oct 1;334(1):152-60.

zaIs2 [lin-14::GFP + rol-6(su1006)]. Rollers, though Rol is not completely penetrant, Reference: Olsson-Carter K, Slack FJ. PLoS Genet. 2010 Aug 5;6(8). pii: e1001054.

Homozygous viable. Slow growth but not lethal or sterile. Reference: Breckenridge DG, et al. Mol Cell. 2008 Aug 22;31(4):586-97.

rjSi1 [cra-1p::cra-1::GFP::cra-1 3'UTR + Cbr-unc-119(+)] II. Single copy insertion. cra-1 promoter, cra-1::GFP and 3'UTR was cloned into pCFJ150 (ttTi5605) vector and inserted into ttTi5605 of EG4322 strain. Outcrossed three times to N2 Bristol; could still carry unc-119(ed9) in the background. Superficially wild-type. This CRA-1::GFP fusion construct has been shown to be functional and its localization reflects endogenous CRA-1 localization. rjSi1 transgene can rescue synapsis defects of cra-1 mutants and restore cross-over events (six bivalents instead of the 11 to 12 univalents characteristic of cra-1 mutants). Brood size and embryonic lethality were significantly, albeit not completely, restored in the rescued line suggesting that the GFP tag might affect other CRA-1 functions. Reference: Gao J, et al. PLOS Genetics 11(3): e1005029. https://doi.org/10.1371/journal.pgen.1005029

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. Linked sterility has not been separated from Odr phenotype.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs30 [glr-1::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-6 is temperature sensitive. Posterior axon from amphid neuron. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-9 is temperature senstive. Amphid axon guidance defects (termination, guidance). This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

sax-3 mutants have an anteriorly-displaced nerve ring, defects in axon guidance to the ventral midline, and extra axon crossing at the ventral midline. There are also defects in CAN and HSN cell migration, a notched head and an Egl phenotype. This allele is 80% lethal in embryonic stages. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs37 [odr-10::GFP + lin-15(+)] II. No lin-15 mutation in background. Translational fusion; first few amino acids of odr-10. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs53[odr-10::GFP]. Full length odr-10. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.