| APL126 |
C. elegans |
ljfSi33 I; ljfSi10 II; egl-17(ljf14[egl-17p::mNG::3xFlag]) X. Show Description
ljfSi33 [myo3p::egl-17::mNG::SL2::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. egl-17(ljf14) was generated by replacing the endogenous egl-17 coding sequence with mNG::3xFlag. Sex myoblast migration defects, Egl. EGL-17::mNG expression in body wall muscles. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi33 is a single copy transgene inserted at Chr I:2851088, near ttTi4348. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| APL242 |
C. elegans |
ljfSi32 I; ljfSi10 II; egl-17(ljf14[egl-17p::mNG::3xFlag]) X. Show Description
ljfSi32 [egl-20 enhancer(-1261 – 610)::pes-10p::egl-17::mNG::SL2::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN]) I. ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Sex myoblast migration defects, Egl. EGL-17::mNG expression in a small number of posterior cells leads to posterior sex myoblast migration in hermaphrodites. egl-17(ljf14) was generated by replacing the endogenous egl-17 coding sequence with mNG::3xFlag. ljfSi32 is a single copy transgene inserted at Chr I:2851088, near ttTi4348. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| APL5 |
C. elegans |
ljfSi2 I. Show Description
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. Single-copy transgenic strain that expressing mTurquoise2::PH plasma membrane marker and mKate2::moesin actin binding domain in the M lineage. lfjSi2 was inserted at Chr I:2851088, near ttTi4348, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| APL622 |
C. elegans |
ljfSi2 I; ljfSi39 IV; egl-17(ljf7[egl-17::mNG::3xFlag]) X. Show Description
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding
domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi39 [myo-3p::egl-15(5a)::SL2::2x mKate2::PH::3xHA::tbb-2 3' UTR lox511i] IV. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. EGL-15(5a) expression in body wall muscle cells captures free EGL-17, reducing long-range signaling and causing moderately penetrant sex myoblast migration defects. ljfSi2 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. ljfSi39 is a single copy transgene inserted at Chr IV:4237723 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| DLW109 |
C. elegans |
wrdSi23 I; unc-104(knu973[unc-104::AID*]) II. Show Description
wrdSi23 [eft-3p::TIR1::F2A::mTagBFP::tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
| DLW110 |
C. elegans |
wrdSi23 I; unc-18(knu969[unc-18::AID*]) X. Show Description
wrdSi23 [eft-3p::TIR1::F2A::mTagBFP::tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
| DLW124 |
C. elegans |
wrdSi22 I; unc-52(knu968[AID*::unc-52]) II. Show Description
wrdSi22 [eft-3p::TIR1::F2A::mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
| DQM104 |
C. elegans |
bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. CRISPR/Cas9-mediated recombination was used to insert eef-1a.1p::GFP into the standard MosSCI insertion site ttTi4348. Reference: Reference: Costa DS, et al. Development. 2023 May 1;150(9):dev201570. doi: 10.1242/dev.201570. PMID: 37039075.
|
|
| DQM1244 |
C.elegans |
bmdSi327 I. Show Description
bmdSi327 [loxN::ckb-3p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. Uterine-specific expression of FLPase in Z1/Z4 and their descendants with blue fluorescent histone reporter for visualization. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315
|
|
| DQM1256 |
C. elegans |
bmdSi346 I; bmdSi297 II. Show Description
bmdSi346 [loxN::lin-31p::FLP]; inserted into safe harbor site ttTi4348 in Chr I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. FLP-ON::TIR1 system for AID-tagged protein degradation in VPCs. High levels of TIR1(F79G) expression in vulval precursor cells by lin-31p::FLP with co-expression of CDK activity sensor. bmdSi297 contains the ubiquitous rpl-28 promoter driving expression of FRT3::STOP::FRT3::TIR1(F79G)::DHB construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315
|
|
| DQM1258 |
C. elegans |
bmdSi348 I. Show Description
bmdSi348 [loxN::rgef-1p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. Pan-neuronal expression of FLPase with blue fluorescent histone reporter for visualization. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315
|
|
| DQM1260 |
C. elegans |
bmdSi350 I. Show Description
bmdSi350 [loxN::wrt-2p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. Hypodermal (seam cell) expression of FLPase with blue fluorescent histone reporter for visualization. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315
|
|
| DQM1283 |
C. elegans |
bmdSi348 I; bmdSi362 II. Show Description
bmdSi348 [loxN::rgef-1p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. bmdSi362 [loxN::rpl-28p::FRT3-LCK::mNG-STOP::FRT3::TIR1(F79G)::2A::PH::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. FLP-ON::TIR1 system for AID-tagged protein degradation in neurons. High levels of TIR1(F79G) expression in neurons by rgef-1p::FLP with co-expression of membrane markers. bmdSi362 contains the ubiquitous rpl-28 promoter driving expression of FRT3-LCK::mNG-STOP::FRT3::TIR1(F79G)::2A::PH::2xmKate2 construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315
|
|
| EG6032 |
C. elegans |
ttTi4348 I; unc-18(md299) X. Show Description
Unc. MosSCI insertion strain with unc-18 marker instead of unc-119. Mos1 insertion in Chr I. Compatible with mosSCI targeting vectors pCFJ448 (Gateway) and pCFJ676 (MCS).
|
|
| EG6173 |
C. elegans |
oxSi259 I; unc-119(ed3) III. Show Description
oxSi259 [eft-3p::GFP + Cbr-unc-119(+)] I. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi4348 on Chr. I. Can be used as balancer.
|
|
| EG6701 |
C. elegans |
ttTi4348 I; unc-119(ed3) III; oxEx1580. Show Description
oxEx1580 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.
|
|
| EG8072 |
C. elegans |
oxSi259 I; oxIs322 II; oxTi81 V. Show Description
oxSi259 [eft-3p::GFP + Cbr-unc-119(+)] I. Cytoplasmic, green fluorescence expressed broadly (most cells). Integration into ttTi4348 mosSCI site (I:-5.32). oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Combined fluorescent balancer strain for LG I, LG II and LG V.
|
|
| EG8776 |
C. elegans |
oxSi255 I; oxIs322 II; oxSi199 IV; him-5(e1490) V. Show Description
oxSi255 [snt-1p::GFP + Cbr-unc-119(+)] I. Integration into ttTi4348 mosSCI site (I:-5.32). Pan-neuronal GFP expression visible under dissection microscope. oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Him. Combined fluorescent balancer strain for LG I, LG II and LG IV. Strain contains him-5(e1490) to generate males for crosses.
|
|
| EG8961 |
C. elegans |
oxSi255 I; oxTi81 him-5(e1490) V. Show Description
oxSi255 [snt-1p::GFP + Cbr-unc-119(+)] I. Integration into ttTi4348 mosSCI site (I:-5.32). Pan-neuronal GFP expression visible under dissection microscope. oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Him. Combined fluorescent balancer strain for LG I and LG IV. Strain contains him-5(e1490) to generate males for crosses.
|
|
| JDW182 |
C. elegans |
bmdSi15 lmn-1(wrd39[lmn-1::1xGFP11]) I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. GFP11 tag inserted into endogenous lmn-1 locus via CRISPR/Cas9 insertion into parental strain DQM104. Reference: Gregory EF, et al. MicroPubl Biol. 2023 Dec 13:2023:10.17912/micropub.biology.001022. doi: 10.17912/micropub.biology.001022. eCollection 2023. PMID: 38152058.
|
|
| LP515 |
C. elegans |
cpIs89 I; cpIs85 II; egl-20(cp221[egl-20::mNG::3xFlag]) IV. Show Description
cpIs89 [wrt-2p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] I. cpIs85 [egl-20p::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN] II. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-20 locus. 2x mTurquoise2::PH membrane marker expressed in seam cells, Q neuroblasts, and many hypodermal cells. Expression of 2x mKate2::PH membrane marker driven by egl-20 upstream intergenic sequence. cpIs89 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. cpIs85 is a single copy transgene inserted at Chr II:8420157-8420243 near ttTi5605 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| LP815 |
C. elegans |
cpIs158 I; cpIs130 II; egl-20(cp400[egl-20::YPET::3xFlag]) IV. Show Description
cpIs158 [myo-3p::pat-3sp::2x vhhGFP4::CD8 tm::2x mTurquoise2::PH::tbb-2 3'UTR loxN] I. cpIs130 [wrt-2p::2x mKate2::PH::3xHA::let-858 3'UTR::tag-168p::HisCl1::tbb-2 3'UTR loxN] II. YPET::3xFlag tag inserted at the C-terminus of the endogenous egl-20 locus. cpIs158 expresses a membrane-anchored anti-GFP nanobody (Morphotrap) in body wall muscles. This version of Morphotrap consists of extracellular 2x vhhGFP4 fused to a human CD8 transmembrane domain and intracellular 2x mTurquoise2. Endogenously tagged EGL-20::YPET::3xFlag is efficiently sequestered by the Morphotrap transgene (the transgene functions as expected for Wnt), leading to Q neuroblast migration defects. NOTE: cpIs158/Morphotrap does not capture all YPET-tagged extracellular proteins, so sequestration should be determined empirically. cpIs130 is a single copy transgene expressing a 2x mKate2::PH membrane marker in seam cells, Q neuroblasts, and many hypodermal cells, and HisCl1 expression from the tag-168 upstream intergenic sequence. Expression of HisCl1 from the single copy insertion does not appear to be sufficient for immobilizing animals. cpIs158 was inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. cpIs130 was inserted at Chr II:8420157-8420243 near ttTi5605. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| NK2694 |
C. elegans |
bmdSi15 rpl-31(qy110[rpl-31::gfp11]) I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus.
|
|
| NK2730 |
C. elegans |
rpl-4(qy128[rpl-4::gfp11]) bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-41 locus.
|
|
| NK2765 |
C. elegans |
qySi120[eef-1A.1p::iATpSnFR1.0::unc-54 3'UTR] I. Show Description
Superfically wild-type strain with ubiquitous somatic expression of ATP biosensor iATPSnFR1.0 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal iATPSnFR1.0 reverse primer: 5' CTTCATCTCGGCGACGGAGAGACGGTT 3'
|
|
| NK2789 |
C. elegans |
bmdSi15 I; shy61(sec-61.B::GFP11x2) IV. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). 2x split GFP tag (GFP11) inserted into the C-terminus of the endogenous sec-61.B locus.
|
|
| NK2902 |
C. elegans |
bmdSi15 I; rpl-31(qy189[rpl-31::ZF1::GFP11]) I; zif-1(gk117) III; qyIs463. Show Description
qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3' UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3' UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus. L4-specific expression of ZIF-1, ubiquitous GFPbeta1-10 and endogenous rpl-31 tagged with ZF-1+GFP-beta11
|
|
| NK3019 |
C. elegans |
qySi218[rpl-28p::tomm-20::mKate2::3xHA::unc-54 3'UTR] I. Show Description
Superfically wild-type strain with ubiquitous expression of red mitochondria outermembrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3027 |
C. elegans |
qySi148 I; lam-2(qy20[lam-2::mNG]) IV. Show Description
qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. mNeonGreen tag inserted into C-terminus of endogenous lam-2 locus. Superfically wild-type strain with AC-specific plasma membrane marker and BM marker. BM visualized with endogenously tagged laminin. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3189 |
C. elegans |
qySi275 I. Show Description
qySi275 [nduv-2p::mNG::P2A::mKate2::unc-54 3'UTR] I. nduv-2 transcriptional reporter fused to mNeonGreen and mKate2. Inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type.
|
|
| NK3236 |
C. elegans |
qySi252 [let-2p::mNG] I. Show Description
qySi252 [let-2p::mNG] I. Single-copy CRISPR-based integration into ttTi4348. Wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3271 |
C. elegans |
qySi296 I. Show Description
qySi296 [eef-1A.1p::SL2::HYlight::tbb-2 3'UTR] I. Ubiquitous somatic expression of glycolysis ratiometric biosensor HYlight inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3299 |
C. elegans |
qySi312 I. Show Description
qySi312 [eef-1A.1p::SL2::HYlight-RA::tbb-2 3'UTR] I. Ubiquitous somatic expression of glycolysis ratiometric biosensor Hylight-reduced affinity (RA) control inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3304 |
C. elegans |
qySi313 I; unc-119(ed4) III; qyIs629. Show Description
qySi313 [lin-29p::ucp-4::SL2::mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR] I. qyIs629 [eef-1A.1p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Ubiquitous somatic expression of ratiometric ATP:ADP biosensor PercevalHR. Anchor cell specific overexpression of mitochondrial uncoupling protein, UCP-4, (expression confirmed by presence of red anchor cell membrane). qySi313 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3314 |
C. elegans |
qySi148 I; unc-119(ed4) III; qyIs636. Show Description
qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3325 |
C. elegans |
qySi316 I. Show Description
qySi316 [nuo-1p::mNG::P2A::mKate2::unc-54 3'UTR] I. Transcriptional nuo-1 reporter fused to mNeonGreen and mKate2 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type.
|
|
| OCF69 |
C. elegans |
ocfSi1 I; unc-119(ed3) III. Show Description
ocfSi1 [mex-5p::Dendra2::his-58/66::tbb-2 3'UTR + unc-119(+)] I. Dendra2::histone H2B expression in the germline and embryos. The H2B coding sequence is identical to genes his-58 and his-66. Made by MosSCI insertion into ttTi4348 on LG I. Reference: Rosu S & Cohen-Fix O. Dev Biol. 2017 Mar 15;423(2):93-100.
|
|
| STR35 |
C. elegans |
hrtSi1 I; unc-119(ed3) III. Show Description
hrtSi1 [mec-17p::ebp-2::gfp + unc-119(+)] I. hrtSi1 inserted into ttTi4348. GFP marker for microtubules. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.
|
|
| STR369 |
C. elegans |
hrtSi41 I; unc-119(ed3) III. Show Description
hrtSi41 [des-2p::unc-33L::GFP + unc-119(+)] I. hrtSi41 inserted into ttTi4348. UNC-33L::GFP expression in PVD and FLP. Functional UNC-33::GFP fusion with internal GFP tag inserted at the start of the S isoform. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.
|
|
| STR512 |
C. elegans |
hrtSi69 I; unc-119(ed3) III. Show Description
hrtSi69 [des-2p::GFP::unc-33s + unc-119(+)] I. hrtSi69 inserted into ttTi4348. GFP::UNC-33S expression in PVD and FLP. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.
|
|
| STR66 |
C. elegans |
hrtSi4 I. Show Description
hrtSi4 [gcy-36p::ebp-2::gfp + unc-119(+)] I. hrtSi4 inserted into ttTi4348. EBP-2::GFP expression in PQR, URX and AQR. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.
|
|
| STR71 |
C. elegans |
hrtSi5 I. Show Description
hrtSi5 [des-2p::ebp-2::GFP + unc-119(+)] I. hrtSi5 inserted into ttTi4348. EBP-2::GFP expression in PVD and FLP. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.
|
|
| STR75 |
C. elegans |
hrtSi9 I. Show Description
hrtSi9 [ceh-10p::ebp-2::gfp + unc-119(+)] I. hrtSi9 inserted into ttTi4348. EBP-2::GFP expression in CAN. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.
|
|
| SX2650 |
C. elegans |
mjSi74 I. Show Description
mjSi74 [mex-5p::wormCherry::prde-1::par-5] I. Integration into ttTi4348. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
|
|