Species Information: C. elegans

Name C. elegans
NCBI Taxonomy ID

C. elegans strains available at the CGC

Strain Genotype Description
PS9675 syIs840; syIs300. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs840 [T09B9.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons.
PS9896 syIs852; syIs300. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs852 [C50F7.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons.
CGC194 dpy-26(n199)/tmC5 [F36H1.3(tmIs1220)] IV. Lethal/sterile dpy-26 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus n199 homozygotes (variable morphology). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Derived by crossing parental strains FX30140 with CB5101 (males).
WJA1004 unc-54(srf1004[unc-54::T2A::FLAG::rareArg12::GFP]) I. Unc. Reporter for no-go mRNA decay. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369.
WJA1025 rps-10(srf1025[rps-10::3xHA]) I. 3xHA tag inserted at C-terminus of endogenous rps-10 locus. Some growth defects on its own, which can be exacerbated in conjunction with mutants of no-go mRNA decay factors. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
WJA1190 rps-20(srf1190[rps-20::3xFLAG]) I. 3xHA tag inserted at C-terminus of endogenous rps-20 locus. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
WJA2119 znf-598(srf2119) II. srf2119 is a 965bp deletion within znf-598. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
WJA780 unc-54(cc4092[unc-54::GFP::T2A::nonstop]) I.; nonu-1(srf780) III. srf780 is a deletion of the Smr nuclease domain of nonu-1. Unc. GFP expression in body wall muscle. Reference: Glover ML, et al. Cell Rep. 2020 Mar 31;30(13):4321-4331.e4. doi: 10.1016/j.celrep.2020.03.023. PMID: 32234470.
WJA730 hbs-1(srf730) I. srf730 is a 900bp deletion within hbs-1. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
WJA1097 rps-10(srf0825[K125R]) rps-20(srf1046[K6R+K9R]) unc-54(srf1004[unc-54::T2A::FLAG::rareArg12::GFP]) I. Nuclear body wall muscle GFP+.
PHX1805 ser-1(syb1805[ser-1::T2A::mNeonGreen]) X. Endogenous ser-1 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Derived in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
PHX1866 ser-4(syb1866[ser-4::T2A::mNeonGreen]) III. Endogenous ser-4 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF409 lgc-50(syb3560[lgc-50::T2A::mNeonGreen]) III. Endogenous lgc-50 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF193 ser-4(flv7) III; flvIs2. flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
VH7000 F21D5.6(hd7000[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Deletion of 964 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAAGCAGATTTTTTTCCAAAAAATGAGCT; Right flanking sequence: CGGATTCTGGTAATTTTGCAGGTTTAGTTT. sgRNA #1: GATTGATTTGGTTCCCTTCG; sgRNA #2: TTTTCTCGAATAACTCTCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7001 gna-1(hd7001[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Deletion of 439 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTAACGTGTGAAATTTAGAAGCGCTGAG; Right flanking sequence: AGGAATGTGTGGAGCTAACACAGACGCATC. sgRNA #1: TCATAAAATTGCAATCGTCC; sgRNA #2: AAATTGTCAGGAAGATTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
PHX7380 cone-1(syb7380[wrmScarlet::cone-1]) III. Broad puncate expression in non-neuronal cells, later expression initiatiated ~1.5-2 fold stage. wrmScarlet tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
OH18463 unc-75(ot1351) I; ceh-44(ot1015[ceh-44::GFP]) III. ot1351 is a CRISPR-engineered deletion of unc-75 gene rendering all 3 RNA recognition motifs null on unc-75; reduces pan-neuronal nuclear GFP expression fluorescence. GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Please contact Oliver Hobert prior to publishing work using this strain.
DWP3 qaIs8001. qaIs8001 [fhod-1::GFP + unc-119(+)]. Integrated functional translational FHOD-1::GFP fusion. Superficially wild-type. Reference: Mi-Mi L, et al. J Cell Biol. 2012 Jul 9;198(1):87-102. doi: 10.1083/jcb.201202053.
DWP294 rhIs2. rhIs2 [pat-3::HA::GFP]. rhIs2 contains cosmid-derived full-length pat-3, including 5 kb 5’UTR and 1 kb 3’ UTR, with HA and GFP(S65C) tags inserted prior to the pat-3 stop codon. Reference: Plenefisch JD, et al. Development. 2000 127(6):1197-207. doi: 10.1242/dev.127.6.1197.
TV28592 bmdSi339 I; bmdSi297 II; arx-2(wy1814[arx-2::mIAA7::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X. bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. mNG tags inserted into endogenous arx-2 and lam-2 loci. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.
TV28593 bmdSi339 I; bmdSi297 II; arx-2(wy1815[arx-2::AID::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X. bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. AID and mNG tags inserted into endogenous arx-2 locus. mNG tag inserted into endogenous lam-2 locus. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.
DQM1138 dpff-1(bmd302[dpff-1p::^SEC^mNG::AID::DPFF-1]) III. Pick Rollers to maintain. Endogenous N-term tagged DPFF-1 with mNG::AID using the self-excising cassette for drug selection. Animals are rollers which contains sqt-1 gene. Remove the SEC for normal expression using the protocol described in "Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics. 2015 Aug;200(4):1035-49. doi: 10.1534/genetics.115.178335. Epub 2015 Jun 3. PMID: 26044593; PMCID: PMC4574250."
DQM935 bmdSi245 I; fos-1(bmd138[fos-1p::LoxP::GFP::FOS-1]) V. bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM973 bmdSi245 I; swsn-4(bmd63[LoxP::GFP::swsn-4]) IV. bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM979 bmdSi245 swsn-8(bmd222[(swsn-8p::swsn-8::GFP]) I. bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM984 bmdSi245 pbrm-1(st12226[pbrm-1::TY1::EGFP::3xFLAG]) I. bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM1041 bmdSi282. bmdSi282 [^loxN^rgef-1p::mKate2-STOP-STOP-VHH4GFP::DAMc1]. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM1261 bmdSi338 I; qyIs225 V; lam-2(qy20[lam-2::mNG]) X. bmdSi338 [^SEC^lin-29p::FLP::p2A::H2B::2xmTurq2] I. qyIs225 [cdh-3p::mCherry::moeABD] V. Pick Rollers to maintain. Wild-type growth and movement. mNG tag inserted into endogenous lam-2 locus. Anchor cell-specific FLP for targeted protein degradation. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.
DQM1118 icbSi228 II; unc-119(ed3) III; ama-1(ers49[ama-1::degron::gfp]) IV. icbSi228 [ttTi5605_right::wrt-2p::wCherry::Dam:linker:egl-13NLS::vhhGFP4::unc-54::unc-119 3'UTR::unc-119::unc-119p::ttTi5605_left)] II. Wild-type growth and movement.
DQM1059 bmdSi245 I; hda-1(bmd134[HDA-1::GFP::loxP]) V. bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Relatively slow growth compared to N2 animals. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM1126 icbSi228 II; unc-119(ed3) III; had-1(bmd134[had-1::GFP::loxP]) V. icbSi228 [ttTi5605_right::wrt-2p::wcherry::Dam:linker:egl-13NLS:vhhGFP4::unc-54::unc1193'UTR::unc-119::unc-119p::ttTi5605_left)] II. Wild-type growth and movement.
DQM1285 bmdSi363 I; egl-43(bmd88[egl-43p::egl-43::LoxP::GFP::egl-43]) II. bmdSi363 [^SEC^ser-2p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
AY172 mrp-1(pk89) X; acEx172. acEx172 [mrp-1p::mrp-1C::SL2::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. mrp-1C (isoform C from cDNA) expressed under its own promoter rescues mrp-1. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
AY173 mrp-1(pk89) X; acEx173. acEx173 [mrp-1::GFP]. Pick GFP+ animals to maintain. Translationally fused MRP-1::GFP expressed under its own promoter rescues mrp-1. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
AY174 mrp-1(pk89) X; acEx174. acEx174 [ges-1p::mrp-1::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. Translational fusion of MRP-1::GFP driven by intestine-specific ges-1 promoter. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
AY175 nmr-1(ak4) II; acEx175. acEx175 [glr-1p::nmr-1::SL2::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. glr-1 promoter drives NMR-1 expression primarily in interneuron, neurons, and ventral nerve cord. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
AY176 nmr-1(ak4) II; acEx176. acEx176 [dc-1p::nmr-1::SL2::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. tdc-1 promoter drives NMR-1 expression primarily in RIM interneurons. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
WBM1344 rpl-22(wbm58[3xFLAG::rpl-22]) II. 3xFlag tag inserted at N-temrinus of endogenous rpl-22 locus. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments.
WBM1340 wbmIs99 IV. wbmIs99 [rab-3p::3xFLAG::rpl-22::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs89] IV. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs89. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WBM1471 wbmIs133 V. wbmIs133 [rab-3p::3XFLAG::rpl-22::SL2::scarlet::rab-3 3'UTR, *wbmIs127] (V:8645000). N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs127. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WBM1339 wbmIs118 I. wbmIs118 [myo-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs114] I. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in muscle. wrmScarlet expression in muscle. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs114. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WBM1364 wbmIs119 V. wbmIs119 [eft-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs88] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in soma. wrmScarlet expression in soma. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs88. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WBM1470 wbmIs131 V. wbmIs131 [nep-17p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs119] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the intestine. wrmScarlet expression in the intestine. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs119. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
AG400 fasn-1(av138[fasn-1::gfp]) I. Homozygous viable, gfp expression in intestine, hypodermis, developing vulva, somatic gonad. Reference: Starich et al. eLife 2020;9:e58619. DOI: https://doi.org/10.7554/eLife.58619
DG4324 pod-2(tn1765[gfp::3xflag::pod-2]) II. Homozygous viable, gfp expression in intestine, hypodermis, somatic gonad, excretory duct, CAN neuron. Reference: Starich et al. eLife 2020;9:e58619. DOI: https://doi.org/10.7554/eLife.58619
JH4072 pgl-3(ax4517[pgl-3::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. 3xFlag tag inserted at C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w.
JH4073 pgl-3(ax4516[pgl-3(delta448-693)::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. 3xFlag tag inserted at truncated C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w.
AY185 acEx185. acEx185 [hsp-16.41p::par-5::VN173 + hsp-16.41p::his-1::VC155 + unc-122p::RFP]. Pick RFP+ animals to maintain. BiFC reporter strain for PAR-5 and histone (H4) proteins interaction. To detect the protein-protein physical interactions, heat shock the animals for 3 hours at 33°C, allow them to recover for 12 hours at 20°C, and observe fluorescent-complementation signals under a high-magnification fluorescence microscope. Reference: Hong C, et al. PLoS Biol. 2021 Mar 31;19(3):e3001169. doi: 10.1371/journal.pbio.3001169. PMID: 33788830.
AY186 acEx186. acEx186 [hsp-16.41p::par-5::VN173 + hsp-16.41p::VC155 + unc-122p::RFP]. Pick RFP+ animals to maintain. Control strain for AY185 strain. Heat shock induces protein expression but NO BiFC complementation. Reference: Hong C, et al. PLoS Biol. 2021 Mar 31;19(3):e3001169. doi: 10.1371/journal.pbio.3001169. PMID: 33788830.