Species Information: C. elegans

Name C. elegans
NCBI Taxonomy ID

C. elegans strains available at the CGC

Strain Genotype Description
RG3354 veDf3 [LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP] V. Homozygous viable. Deletion of 4002 bp removes his-8, his-7, his-6, his-5, and his-39, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGGTGATTTGCTTTCAGCAATTGAATGC ; Right flanking sequence: GCATTCAATTGCTGAAAGCAAATCACCGAA. his-8/his-39 sgRNA #1: ATTGAATGCTTACTTGCTAG; his-8/his-39 sgRNA #1: ATTGAATGCTTACTTGCTAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3342 xpd-1(ve841[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Late larval arrest. Deletion of 11823 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve842 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+.  [NOTE: xpd-1 is located near the end of the region of LG III balanced by sC1, thus not known if truly balanced by sC1.] Left flanking Sequence: CCGGATAAGCTTGATAAGCTTGTCTATTGT; Right flanking sequence: AGTTATTACGCTATCATGTCATGATGCTTC. xpd-1 sgRNA #1: TCCAGAACTATTCCAGGTAG; xpd-1 sgRNA #2: GCCAGTTGACTACCATCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RHS41 uthSi7 IV. uthSi7 [myo-3p::LifeAct::mRuby::unc-54 3'UTR, Cbr-unc-119(+)] IV. Single-copy insertion of LifeAct::mRuby labels F-actin in body wall muscle cells. Out-crossed to N2. Reference: Higuchi-Sanabria R, et al. Mol Biol Cell. 2018 Oct 15;29(21):2522-2527. doi: 10.1091/mbc.E18-06-0362. PMID: 30133343
RHS42 uthSi10 IV. uthSi10 [col-19p::LifeAct::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] IV. Integrated into cxTi10816. Single-copy insertion of LifeAct::mRuby labels F-actin in hypodermis beginning at late L4 stage. Out-crossed to N2. Reference: Higuchi-Sanabria R, et al. Mol Biol Cell. 2018 Oct 15;29(21):2522-2527. doi: 10.1091/mbc.E18-06-0362. PMID: 30133343
RHS43 uthSi13 IV. uthSi13 [gly-19p::LifeAct::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] IV. Integrated into cxTi10816. Single-copy insertion of LifeAct::mRuby labels F-actin in intestinal cells. Out-crossed to N2. Reference: Higuchi-Sanabria R, et al. Mol Biol Cell. 2018 Oct 15;29(21):2522-2527. doi: 10.1091/mbc.E18-06-0362. PMID: 30133343
UTX113 par-3(djd33[mScarlet-I-GLO::Myc::par-3]) III. mScarlet-I-GLO and Myc tags inserted into endogenous par-3 locus. mScarlet-I-GLO is a germline-optimized variant coded to be less prone to silencing in the germline. Reference: Chang Y & Dickinson DJ. Cell Rep. 2022 Apr 12;39(2):110652. doi: 10.1016/j.celrep.2022.110652. PMID: 35417695.
AD319 spe-38(syb6556[spe-38::wrmScarlet-I]) I; him-5(e1490) V. wrmScarlet-I tag inserted into endogenous spe-38 locus. Him. wrmScarlet-I expression labels membranous organelles (MOs) in the sperm. Reference: Zuo Y, et al. Biomolecules. 2023; 13(4):623. https://doi.org/10.3390/biom13040623
ZT60 csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in this csr-1 null-mutant homozygotes. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. The inversion-based balancer in ZT60 is more amenable to producing csr-1(fj54) homozygous males than a translocation-based balancer (ZT3). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT46 csr-1(fj67) IV/nT1 [qIs51] (IV;V). Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj67) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Intracellular localization of CSR-1 is abnormal in the csr-1(fj67) homozygotes. fj67 is a 60-bp in-frame deletion of the first lysine-rich region (KQKDNFILLDILLKQWAAKK) in CSR-1. The first lysine-rich region in the WT has a FokI site. The deletion can be checked by PCR with the following primers: CACCTGTGATTTTTCGGGGAAC and TGGATTCCTTTTGCTGCAACAG, followed by digestion with FokI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT47 csr-1(fj70) IV/nT1 [qIs51] (IV;V). Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj70) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj70 is a D769L mutation that renders CSR-1 (an Argonaute protein) catalytically defective and generates a new SphI site. The fj70 mutation can be checked by PCR with the following primers: TACACGTGGATGATGAGAAG and TCGTCCGAAACTTCCTCATC, followed by digestion with SphI. Homozygous nT1[qIs51] inviable. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT57 csr-1(fj126) IV/nT1 [qIs51] (IV;V). Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj126) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj126 was generated by the insertion of a synthetic nuclear export signal (NES). Instead of six amino-acid residues (R8–I13) near the N-terminus of CSR-1b, an NES sequence (LNELALKLAGLDI) from the cAMP-dependent protein kinase inhibitor alpha in mammals was inserted into the endogenous csr-1 gene. The DNA sequence encoding the NES has a HindIII site. The fj126 mutation can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and CCGCTGAGGAACGAGATGG, followed by digestion with HindIII. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT61 vsra-1(tm1637) I; csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in homozygous tm1637; fj54 double mutants. The vsra-1 mutation enhances the defects caused by the csr-1 mutation. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. tm1637 can be detected by PCR with the following primers: AAGCAGTTCTTCAAGACTGGTC and TTGTCCACTCGCACTTTGTG. The fj54 deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT62 met-2(ok2307) set-25(n5021) III. Maintain at 20C or lower. The met-2 set-25 double mutant exhibits partial sterility and no significant defects in chromosome segregation. MET-2 and SET-25 are the methyltransferases responsible for histone H3K9me2 and H3K9me3. The deletion mutations can be checked by PCR with the following primers: met-2(ok2307), GGTTGATGCGGAGAAGACTG and AATGGATTCGGTGCTTCGTG; set-25(n5021), GAGCCCGTGCCACAGAGTAG and CCTAGAGCGATGTCCTTGATGG. This strain was used as a negative control in the immunodetection of H3K9me2.
ZT33 cec-8(fj63) III. No apparent phenotype. The chromodomain protein CEC-8 is phylogenetically similar to CEC-5 and CEC-4. fj63 is a 14-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-8 (Y55B1BR.3). The fj63 deletion can be detected by PCR with the following primers: GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT29 cec-4(ok3124) cec-5(fj58) IV. Maintain at 20C or lower. The cec-4 cec-5 double mutant exhibits partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-4 and CEC-5 are phylogenetically similar to CEC-8. ok3124 is a 374-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-4 (F32E10.2). The ok3124 deletion can be detected by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj58 is a 398-bp deletion located in the gene region corresponding to the N-terminus of CEC-5 (F32E10.6). The fj58 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT31 cec-4(ok3124) cec-5(fj61) him-8(e1489) IV. Maintain at 20C or lower. Him. cec-4 cec-5 him-8 triple mutants exhibit partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. ok3124 deletion can be detceted by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj61 is a 444-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-5 (F32E10.6). The fj61 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT34 cec-8(fj63) III; cec-4(ok3124) cec-5(fj58) IV. Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT35 cec-8(fj63) III; cec-4(ok3124) cec-5(fj61) him-8(e1489) IV. Maintain at 20C or lower. Him. The cec-8; cec-4 cec-5 him-8 quadruple mutant exhibits partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT36 ego-1(om58) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT and GFP+ and segregate WT GFP+ heterozygotes, non-GFP ego-1 homozygotes (sterile with inaccurate homologous pairing of meiotic chromosomes), very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT58 fjDf1 fjDf2 fjDf3 fjDf4 X. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT63 csr-1(fj150) IV. RNAi deficient (Rde). Him. Partially-inaccurate paring of meiotic chromosomes. fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT64 csr-1(fj150) IV; fjDf1 fjDf2 fjDf3 fjDf4 X. fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. fj150 is enhanced by the CeRep55 quadruple deletion. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT68 csr-1(fj162) Ⅳ. RNAi deficient (Rde). High incidence of males (Him). fj162 at the second K-rich region is an in-frame duplication (comprising of a small duplication and a tiny inverted duplication) generating 61 extra amino acids. The fj162 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC.
ZT69 csr-1(fj162) Ⅳ; fjDf1 fjDf2 fjDf3 fjDf4 X. fj162 at the second K-rich region is an in-frame duplication (comprising of a small duplication and a tiny inverted duplication) generating 61 extra amino acids. The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the csr-1(fj162) mutant is enhanced by the CeRep55_X quadruple deletions. The fj162 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT65 him-1(e879) I; fjDf1 fjDf2 fjDf3 fjDf4 X. The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the him-1(e879) mutant is enhanced by the CeRep55_X quadruple deletions. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. The e879 mutation can be checked by PCR with the following primers: AAATCAGGAGTGGGCATCAG and GGGAAGATTCCGATGAGTGA, followed by digestion with MvaI. The wild-type him-1 gene contains an MvaI site within its PCR region, while the e879 allele does not. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT72 dpy-5(e61) I; fjDf1 fjDf2 fjDf3 fjDf4 X. This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT22 fjSi1 II; csr-1(fj54) IV. fjSi1 [2×FLAG::csr-1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×FLAG::csr-1 transgene was designed to express proteins with a double FLAG tag instead of the N169 of CSR-1a and N6 of CSR-1b. The linker sequence between the two FLAG tags has a NotI site. The insertion can be checked by PCR with the following primers: CACACTCGATTCTACGCCAA (at the 3'-side of csr-1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT24 vsra-1(tm1637) I; fjSi3 II. fjSi3 [HA_2×FLAG::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The HA_2×FLAG::C04F12.1 transgene was designed to express a protein with an HA tag and a double FLAG tag inserted after S21 of C04F12.1. The linker sequence between the HA tag and the double FLAG tag has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT56 fjSi19 II; unc-119(ed3) III. fjSi19 [rpl-21p::2×HA::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×HA::C04F12.1 transgene was designed to express a protein with a double HA tag at its N-terminus, using a strong ubiquitous promoter (rpl-21p). The linker sequence between the two HA tags has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
OH18424 pha-1(e2123) III; otEx8047. otEx8047 [pks-1p::TagRFP + pha-1(+)]. Maintain at 25C to select for array. TagRFP expression marks CAN neurons.
JDW460 noah-1(wrd119[noah-1::linker::mNeonGreen(dpiRNA)::3xFLAG(internal)::linker]) I. Internal mNeonGreen(dpiRNA)::3xFLAG tags with linker sequences inserted into endogenous noah-1 locus. mNeonGreen(dpiRNA) is optimized to remove all piRNA sites. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.
JDW389 bli-1(wrd84[bli-1::linker::mNeonGreen::3xFLAG(internal)::linker]) II. Internal mNeonGreen::3xFLAG tags with linker sequences inserted into endogenous bli-1 locus. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.
RG3359 got-2.2(ve859[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 1476 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAGCGTTTCCAAGAAGCTTTTCTCTACCG ; Right flanking sequence: AAGTAAATCAGTGACAAATGCACTCTTCCC. got-2.2 sgRNA #1: CCGTGCGAGGAAAGTCGTGG; got-2.2 sgRNA #2: GGTGACTTGGTGGAGAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3360 F46B6.12(ve860[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 597 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTGGATCACGAATGGTGGTGAATTGGGA ; Right flanking sequence: TTCAATTGACACTTCAGTTCGAGAGCAAGA. F46B6.12 sgRNA #1: GGACATCTCGCTAATCTCAA; F46B6.12 sgRNA #2: AGGTATCACTGATCTTCGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3358 F40F9.10(ve858[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 1891 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCACCATATCTTATCATATTGACAACCG ; Right flanking sequence: CCATTGAGGTTAAAAGAAGAACGAAGTCCG. F40F9.10 sgRNA #1: TGATCTCATGTATTCAGTGA; F40F9.10 sgRNA #2: AGAGAACGTCCAGTTTACGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3364 C27H6.8(ve864[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 921 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCTCCTATTTCGAGAGCTTTCCGTGCCA ; Right flanking sequence: CTTCTCCAGTTGAGCAGCGTCACGGGTTCT. C27H6.8 sgRNA #1: TCGTGAAGGAGCAATTGCCA; C27H6.8 sgRNA #2: TGTGATATTATCGTCGATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3365 anmt-3(ve865[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 1020 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCTTTGCGGAAACCATGAACATTCCATTGA ; Right flanking sequence: ACTATTACACTGGAAACATTGAATGAGATT. anmt-3 sgRNA #1: TTTCATAAAGAACACATCCA; anmt-3 sgRNA #2: ATTGAACATTCAGACCAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
JAR50 rack-1(rns8[rack-1::mScarlet]] IV. mScarlet tag inserted into endogenous rack-1 locus. Ubiquitous mScarlet expression.
MS1893 unc-119(ed9) III; irSi24 IV. irSi24 [pept-1::mCherry::H2B + Cbr-unc-119(+)] IV. Single-copy MosSCI insertion of pept-1 reporter into cxTi10882 site in LG IV. mCherry fluorescence exclusively in intestinal nuclei from the end of embryonic development through adulthood. Generated in N2 background. Reference: Maduro MF, et al. Dev Biol 2015 Aug 1;404(1):66-79. doi: 10.1016/j.ydbio.2015.04.025, PMID:25959238.
AUM1870 ZK813.1(viz166[fln-1p::ZK813.1]) X. The endogenous promoter of ZK813.1 (1046 bp) was replaced with the fln-1 promoter (947 bp) to limit the expression of ZK813.1 to the spermatheca and allow analysis of RNA transfer from soma to oocytes. Reference: Trimmer KA, et al. Cell Rep. 2023 May 23;42(6):112544. doi: 10.1016/j.celrep.2023.112544. PMID: 37227820. .
SHX3908 C42D4.3(zju273[C42D4.3::8×MS2]) IV; zjuEx2144. 8xMS2 tag inserted at C-terminus of endogenous C42D4.3 locus. zjuEx2144 [semo-1p::MCP::24×Suntag + col-19p::scFv::sfGFP + ttx-3p::RFP]. Pick ttx-3::RFP+ animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. zjuEx2144 transgene expression provides MS2 coat protein (MCP) fused to 24xSuntag and scFv tagged with GFP. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.
SHX3909 mai-1(zju271[mai-1::8×MS2]) X; zjuEx2144. 8xMS2 tag inserted at C-terminus of endogenous mai-1 locus. zjuEx2144 [semo-1p::MCP::24×Suntag + col-19p::scFv::sfGFP + ttx-3p::RFP]. Pick ttx-3::RFP+ animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. zjuEx2144 transgene expression provides MS2 coat protein (MCP) fused to 24xSuntag and scFv tagged with GFP. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.
SHX4319 zjuEx2429. zjuEx2429 [col-19p::BFP::8xMS2 + semo-1p::MCP::24×Suntag + col-19p::scFv::sfGFP + myo-2p::GFP]. Pick GFP+ (pharynx) animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.
RG3362 cyp-33B1(ve862[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 2219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTCTTCCTTATTCATCAATATTTGTGG ; Right flanking sequence: CGCGTTAGATCACGAAATTGTCACACTGAA. cyp-33B1 sgRNA #1: CGGCGAAGAGGATTACCACC; cyp-33B1 sgRNA #2: ACATTTATATGGAATGACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3357 pfk-1.2(ve857[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 2435 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGAAGTTTAAAAAAGGAAAGGACCATGGA ; Right flanking sequence: TGGTTGGATTTGCATCCCCTTGTTGAAGCA. pfk-1.2 sgRNA #1: GTTGGAGTGCTGACTAGTGG; pfk-1.2 sgRNA #2: GAGTTCCACATAACATGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3361 F44A2.5(ve861[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 2053bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AACAGACCCGCCATGCAAATTTACCGTCCA ; Right flanking sequence: TGGGCCCGTAAAATGATTCTCCTTCTCTTG. F44A2.5 sgRNA #1: ATGTAAAGTCACTTACCAGG; F44A2.5 sgRNA #2: TCATTGACGTCTCCGAACCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7031 dlat-1(hd7031[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V. Heterozygous strain, might not be homozygous viable. Deletion of 1998 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGCATCGTGTGTGGCTTCTCGAGGAACTC; Right flanking sequence: TTTATCACACCGATTTTTTTTTATTTTCGC. sgRNA #1: CTTGAAGTGACGAAGCCAGA; sgRNA #2: CAAGGCGCGCGTGTTTAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7032 npp-1(hd7032[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Heterozygous strain, might not be homozygous viable. Deletion of 3583 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGAGGAGGGTGCCAGCAAACGCGCCCCT; Right flanking sequence: TGGCAGAAAATTGTTTTTAAAACTTATACA. sgRNA #1: CGAATTTTGTCTGTGTACGA; sgRNA #2: CTGTTTCGACCTAAGATGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7033 F36G9.3(hd7033[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 2120 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTTTTGGGTTTCAAAATGAAGTATTTACCA; Right flanking sequence: TTTCAATATTCTCAATTCTGGCACTCATAT. sgRNA #1: TAAAACTAGACGGACGAGTC; sgRNA #2: GGATTGTGAGCACCCAGTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7034 F17C8.6(hd7034[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Homozygous viable. Deletion of 872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGAAGATTTTGCATTGATTTTTAGATAGT; Right flanking sequence: TGCAACCATTTTAAGATTGTTTATTTGAAA. sgRNA #1: AAAGTACACGTATGCCACCT; sgRNA #2: CCATACCATCAGGAGGCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.