| ZM10829 |
hpEx4271. |
hpEx4271 [gbb-2(fosmid)::GFP + myo-2p::RFP]. Pick animals with red fluorescence to maintain. GBB-2::GFP expression in muscles and neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10743 |
unc-49(e407) III; gbb-2(tm1165) IV; hpIs592; ljIs131. |
hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10441 |
unc-49(e407) III; hpIs592; ljIs131. |
hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10410 |
gbb-2(tm1165) IV; hpIs593; ljIs131. |
hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. D motor neurons are marked with red fluorescence. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM8615 |
hpIs371; hpIs365. |
hpIs371 [unc-4p::miniSOG::SL2::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM8614 |
hpIs372; hpIs365. |
hpIs372 [acr-5p::miniSOG::SL2::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10176 |
unc-25(e156) III; hpIs593; ljIs131. |
hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10311 |
unc-25(e156) III; ljIs131; hpIs758. |
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Shrinker. RFP expression in AVA and a few other neurons. Reversal upon green light illumination with ATR. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM9648 |
hpIs673; ljIs131. |
hpIs673 [rgef-1p::Chrimson::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. All neurons are marked with red fluorescence. Pan-neuronal activation and muscle contraction upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM9660 |
unc-25(e156) III; hpIs673; ljIs131. |
hpIs673 [rgef-1p::Chrimson::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. All neurons are marked with red fluorescence. Pan-neuronal activation and muscle contraction upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM9429 |
zxIs6; ljIs131. |
zxIs6 [unc-17p::ChR2::YFP + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Body contracts and coils dorsally upon blue light illumination on ATR plates. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM9573 |
unc-25(e156) III; zxIs6; ljIs131. |
zxIs6 [unc-17p::ChR2::YFP + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Cholinergic activation. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM7465 |
hpIs321; hpIs331; ljIs131. |
hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10484 |
unc-25(e156) III; hpIs321; hpIs331; ljIs131. |
hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Dorsal-coiler in L1, kinker in Adult after 1 hr illumination with blue light. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM11006 |
ljIs131; hpEx4340. |
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4340 [nmr-1p::TeTx::wCherry + sra-11p::TeTx::wCherry + HygromycinR]. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Transgenic animals are severely Unc. RFP positive head neuron soma can be observed under V16 in older animals. Hygromycin can be used to select for hpEx4340 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701. |
| ZM11020 |
ljIs131; hpEx4343. |
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4343 [acr-5p::TeTx::wCherry + unc-4p::TeTx::wCherry + HygromycinR]. Pick animals with wCherry expression in ventral cord neurons to maintain hpEx4343. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Animals carrying hpEx4343 rest as coilers strongly biased towards ventral bend as L1 larvae and are severely Unc as adults. Coiling is somewhat suppressed in the ljIs131 background, but animals still exhibit an obvious bias towards ventral bend during movement. Hygromycin can be used to select for hpEx4343 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701. |
| ZM10281 |
hpIs740. |
hpIs740 [twk-40(s)p::GCaMP6s::wScarlet + lin-15(+)]. GCaMP and RFP expression in AVA, AVB, AVE and DVA. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM7419 |
hpIs363. |
hpIs363 [sra-11p::ChR2::YFP + ttx-3p::RFP]. YFP expression in AVA. RFP expression in AIY. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| KDK53250 |
oskEx53250. |
oskEx53250 [dat-1p::GCaMP6f + dat-1p::mCherry + lin-44p::mRFP + N2 genomic DNA cut with Pvu II (as a carrier)]. Pick animals with red fluorescence to maintain. GCaMP6f and mCherry expressed in dopaminergic neurons. Generated in N2 background. Reference: Tanimoto Y, et al. Sci Rep. 2016 May 19;6:26297. doi: 10.1038/srep26297. PMID: 27193056. |
| OH16377 |
ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otIs356 V; otDf1 X. |
otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. CUT Sextuple mutant animals show reduced pan-neuronal gene expression, impaired locomotion and resistance to aldicarb induced paralysis. otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341. |
| HT1361 |
lpIs32. |
lpIs32 [ftt-2::gfp + rol-6]. Rollers. FTT-2::GFP is expressed strongly in the pharynx, and can be observed in the neurons in the head, body and tail, and also weakly expressed in the intestine. Reference: Wang Y, et al. Mech Ageing Dev. 2006 Sep;127(9):741-7. PMID: 16860373. |
| OH18011 |
pha-1(e2123) III; otEx7947. |
otEx7947 [W02A2.5p::GFP + pha-1(+)]. I3 neurons are labeled with GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
| OH18043 |
rab-3(ot1178 syb3072) II; him-8(e1489) IV. |
CRISPR-engineered mutation of CUT transcription factor binding site in endogenously-tagged rab-3(syb3072[rab-3::T2A::3xNLS::GFP]). Causes a reduction in rab-3 expression. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| JK6673 |
fzr-1(q1290[3xV5::fzr-1]) II. |
Endogenous fzr-1 locus tagged with 3xV5 close to the N-terminus. Insertion site is a few amino acids downstream of start site (...PAN-3xV5-SPA…). Primer sequences to validate the strain: slc316 GCTTTTGCGTGTTCTCCTCA, slc317 TGAATCCTGAGTCATCATCCGAGT, WT product 347 bp, q1290[3xV5::fzr-1] product 485 bp. |
| PHX5400 |
golg-5(syb5400[golg-5::wrmScarlet]) I. |
wrmScarlet tag inserted at the C-terminus of the endogenous golg-5 locus by CRISPR. Broad punctate expression. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6325 |
unc-13(syb6325[unc-13::SL2::GFP::H2B) I. |
GFP tag inserted at the C-terminus of the endogenous unc-13 locus by CRISPR. Nuclear neuronal and hypodermal expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6123 |
T07A9.10(syb6123[T07A9.10::SL2::GFP::H2B) IV. |
GFP tag inserted at the C-terminus of the endogenous T07A9.10 locus by CRISPR. Punctate ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6153 |
latd-1(syb6153[latd-1::GFP) X. |
C39D10.6. GFP tag inserted at the C-terminus of the endogenous latd-1 locus by CRISPR. Punctate GFP expression in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6394 |
Y71G12B.26(syb6394[Y71G12B.26::GFP]) I. |
GFP tag inserted at the C-terminus of the endogenous Y71G12B.26 locus by CRISPR. Expression of GFP in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6345 |
W02D7.3(syb6345[GFP::W02D7.3]) V. |
GFP tag inserted at the N-terminus of the endogenous W02D7.3 locus by CRISPR. Expression of GFP in pharynx, excretory gland cell, and some additional cells in the head. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6304 |
syx-3(syb6304[syx-3::SL2::GFP::H2B]) X. |
GFP tag inserted at the C-terminus of the endogenous syx-3 locus by CRISPR. Ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6466 |
F36D1.23(syb6466[F36D1.23::tagRFP]) I. |
tagRFP tag inserted at the C-terminus of the endogenous F36D1.23 locus by CRISPR. Strong and specific expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6541 |
spex-2(syb6541[spex-2::SL2::GFP]) I. |
GFP tag inserted at the C-terminus of the endogenous spex-2/F36D1.7 locus by CRISPR. Expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5859 |
ceh-48(syb5859[flag::NLS::Cre::SL2::ceh-48]) IV. |
Cre inserted into the endogenous ceh-48 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5804 |
egl-3(syb5804[flag::NLS::Cre::SL2::egl-3]) V. |
Cre inserted into the endogenous egl-3 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5755 |
pha-4(ot946 ot1078 syb5755[pha-4::3xGAS::GFP::3xGAS::AID::TEV::LoxP::3xFLAG]) V. |
Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain. |
| WF2183 |
cwEx417. |
cwEx417 [cfz-2p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Generated in N2 background. |
| WF2516 |
mnp-1(gm85) III. |
Unc. Sma. Reference: Craft TR & Forrester WC. Dev Biol.2017 Apr 1;424(1):18-27. PMID: 28238735 |
| WF2575 |
cwEx486. |
cwEx486 [mnp-1p::mnp-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. Generated in N2 background. |
| WF1863 |
cam-1(gm122); cwEx266. |
cwEx266 [cam-1p::cam-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. Unc. GFP-tagged CAM-1 rescues gm122. Generated in N2 background. |
| PHX2880 |
ceh-16(syb2709[loxP] syb2880[ceh-16::loxP::GFP]) III. |
GFP tag inserted at the C-terminus of the endogenous ceh-16 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX3936 |
nlp-51(syb3936[nlp-51::SL2::GFP::H2B]) II. |
GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933. |
| PHX4413 |
flp-27(syb4413 [flp-27::SL2::GFP::H2B]) II. |
GFP tag inserted at the C-terminus of the endogenous flp-27 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933. |
| PHX4406 |
nlp-73(syb4406 [nlp-73::SL2::GFP::H2B]) V. |
GFP tag inserted at the C-terminus of the endogenous nlp-73 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX4678 |
ceh-30(syb4678[ceh-30::GFP]) X. |
GFP tag inserted at the C-terminus of the endogenous ceh-30 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| OH18108 |
otIs669 V; nlp-66(syb4403[nlp-66:SL2:GFP::H2B])X. |
GFP tag inserted at the C-terminus of the endogenous nlp-66 locus by CRISPR. Allele generated by SUNY Biotech. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX3203 |
flp-6 (syb3203 [flp-6::T2A::3XNLS::GFP]) V. |
GFP tag inserted at the C-terminus of the endogenous flp-6 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX5536 |
ins-9(syb5536[ins-9::SL2::gfp::H2B]) X. |
GFP tag inserted at the C-terminus of the endogenous ins-9 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX4517 |
nmur-2(syb4517 [nmur-2::SL2::GFP::H2B)] II. |
GFP tag inserted at the C-terminus of the endogenous nmur-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX3277 |
flp-13 (syb3277 [flp-13::T2A::3XNLS::GFP]) IV. |
GFP tag inserted at the C-terminus of the endogenous flp-13 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |