JH3679 |
mex-5(ax3050[mCherry::mex-5]) IV; par-1(ax4206[par-1::meGFP]) V. |
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Homozygous mex-5(ax3050[mCherry::mex-5]); par-1(ax4206[par-1::meGFP]) animals are fully viable and fertile. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118. |
JH3678 |
mex-5(ax3050[mCherry::mex-5])/nT1[qIs51] IV; par-1(ax4209[par-1(T983A)::meGFP])/nT1[qIs51] V. |
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type myo-2::GFP+ and segregate non-myo-2::GFP ax3050; ax4209 homozygotes (maternal effect lethal), wild-type myo-2::GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type myo-2::GFP+ and check for correct segregation of progeny to maintain. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118. |
JH3296 |
mex-5(ax3050[mCherry::mex-5]) IV. |
mCherry tag inserted into endogenous mex-5 locus. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. |
RG3347 |
F59E11.2(ve847[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 1484 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGGGTGTTATACTACAAGATCAAGTGGCT ; Right flanking sequence: GGGTAATCTGGCAAAGTGTAAACCGCTTTT. F59E11.2 sgRNA #1: CTTGTCACAGGTGCTTCCCG; F59E11.2 sgRNA #2: ACAAATCAAGCTACCAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
RG3351 |
ttc-17(ve851[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 4149 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCGCGTGGAATACGACTGCAATCCGACAG ; Right flanking sequence: GGAAAGAATTCGAGTTTTAATTGTTGAATT. ttc-17 sgRNA #1: TTTCCACACGTCTTTCACCG; ttc-17 sgRNA #1: CAGCATGGCAATATATCGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
RG3346 |
C25E10.5(ve846[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 1601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGTTGATCATTGTCGCTGGAATAGTTTCCG ; Right flanking sequence: TGGCTCATCAAATCATCCGTTTTCTTCGCA. C25E10.5 sgRNA #1: ATTTTCCACGGCATTCAATG; C25E10.5 sgRNA #2: TAGTGGTCCAACTCCCAGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
RG3349 |
R03H10.7(ve849[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1234 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTAAGATGTATAATACAATGGTGTTGAAG ; Right flanking sequence: TAAATCGAGATTTTAATGAAATTATTACAT. R03H10.7 sgRNA #1: TTATGTTGGAATTTGACTGA; R03H10.7 sgRNA #2: CAGTTCTGCTATGTGCTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
RG3345 |
ppfr-1(ve845[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous viable. Deletion of 5994 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGGATCCATAGGTATATCCAGTTCATCCT ; Right flanking sequence: TAAAATCATCCGATGTGTCTTCCGAAAATG. ppfr-1 sgRNA #1: TGAGAATGTTAAGAATACTG; ppfr-1 sgRNA #2: GAACACTTCCTAAAGATACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
RG3350 |
arc-1(ve850[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 2121 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCAGCAAATGTTTCAGTTAATGAATGAATA ; Right flanking sequence: GCCCTGTATAGTTTTCTGTCGGAATTTATA. arc-1 sgRNA #1: TGGTTGCAACGTGTGCAACG; arc-1 sgRNA #2: ATGTACCATTAAGACGACTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
VH7018 |
col-144(hd7006[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 1165 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAACATATACATAGGTTACTACGATCCCA; Right flanking sequence: AGTAAGGTCATTCTGCGTCTCTCTTCATTT. sgRNA #1: AGAACCGCAATTACGATTAT; sgRNA #2: CAAAAGAATCTGCCGATGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
VH7019 |
W10C8.4(hd7005[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous viable. Deletion of 1936 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGTTTACAAAGTTTTAGCGGCCGACACCT; Right flanking sequence: AGGAATGATTCAAGATATATATATATATAG. sgRNA #1: TCTTATCTTAGAAACCCGCG; sgRNA #2: CTGTGTGTGAATACCAATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
VH7020 |
gst-28(hd7007[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 991 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTACTGAGTATCTGGACGAGCCTCTACCCA; Right flanking sequence: CGGAAGTCCTCGAATGGAACATCTGCCAAG. sgRNA #1: CAATTCCAGCTATCAGGAAG; sgRNA #2: TTCCATCTCCGTGTGTCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
VH7022 |
ctf-18(hd7009[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
VH7025 |
F28H1.4(hd7025[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous viable. Deletion of 3045 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAGTTGGGTGAAAAAGATCTTGCGAATTA; Right flanking sequence: AGGGAACTGTTCGAGAAAAAATGGGACAAG. sgRNA #1: GAGGGTGATACGTACATGTA; sgRNA #2: AAGAAAATGGGGAAACACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
VH7026 |
lbp-5(hd7016[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCTGATAATAAAACTTTCTTCAAATGCG; Right flanking sequence: GGCGGGCAACAAGGTTAAACGATGGCCAAT. sgRNA #1: AACTTTCTTCAAATGCGAGT; sgRNA #2: TTTAACGTGGAAGAGATGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
VH7028 |
F33D11.1(hd7023[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous viable. Deletion of 515 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGAATCAAGCCCCAGTTGGCAGTCATTT; Right flanking sequence: TGGGATCTTCAACTTCGGATGATTGTTTGC. sgRNA #1: CATACAATGCCACACACGCG; sgRNA #2: GTGTTCATTCCGATTGTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
VH7030 |
F43C1.7(hd7013[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. |
Homozygous viable. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGATAAAAATTAGGTATTTCAGGTTTTCCA; Right flanking sequence: GGGTTACTGTAGACGAAATGAATCCGAAAA. sgRNA #1: AACAACTTGAAGGAACTCAA; sgRNA #2: CATAAATATTAAAGCCGGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
PHX893 |
nish-1(syb767) IV. |
Shorter body length. Reference: Bennett DF, et al. Aging Cell. 2023 Feb;22(2):e13774. doi: 10.1111/acel.13774. PMID: 36670049. |
JH3867 |
bqSi189 II; npp-10(ax4538[mNeonGreen::npp-10]) III. |
bqSi189 [lmn-1p::mCherry::his-58::pie-1 3'utr] II. mNeonGreen is inserted at the N-terminus of the endogenous npp-10 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
JH3938 |
bqSi189 II; npp-9(ax4540[mNeonGreen::npp-9]) III. |
bqSi189 [lmn-1p::mCherry::his-58::pie-1 3'utr] II. mNeonGreen is inserted at the N-terminus of the endogenous npp-9 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
JH4201 |
npp-11(ax4547[npp-11::wrmScarlet]) I. |
wrmScarlet is inserted at the C-terminus of the endogenous npp-11 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
JH3906 |
ran-2(ax4545[ran-2::wrmScarlet]) III. |
wrmScarlet is inserted at the C-terminus of the endogenous ran-2 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
JH4202 |
npp-22(ax4549[npp-22::wrmScarlet]) V. |
wrmScarlet is inserted at the C-terminus of the endogenous npp-22 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
JH3872 |
npp-14(ax4548[npp-14::OLLAS]) I. |
OLLAS is inserted at the C-terminus of the endogenous npp-14 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
JH3955 |
bqSi189 II; xpo-1(ax4542[xpo-1::mNeonGreen]) V. |
bqSi189 [lmn-1p::mCherry::his-58::pie-1 3'utr] II. mNeonGreen is inserted at the C-terminus of the endogenous xpo-1 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
JH3886 |
npp-14(ax4543) I. |
ax4523 is a deletion residues 24-1387 of the npp-14 coding region. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
JH4012 |
gtbp-1(ax4561[gtbp-1p::IBB domain::mNeonGreen::gtbp-1 3'utr]) IV. |
The Importin Beta Binding domain (IBB)::mNeonGreen reporter replaces gtbp-1 in the endogenous gtbp-1 locus. Sterile at 25C; maintain at 20C. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
JH3904 |
tdp-1(ax4546[tdp-1::wrmScarlet]) II. |
wrmScarlet is inserted at the C-terminus of the endogenous tdp-1 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
ZM11177 |
hpIs860. |
hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA). |
ZM11207 |
twk-40(bln336) III; hpIs860. |
hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. twk-40 gain-of-function allele. Paralyzed, no backward movement upon head touch. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA). |
ZM11208 |
twk-40(hp834) III; hpIs860. |
hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. Loopy movement with increased reversals. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA). |
ZM8302 |
twk-40(hp834) III. |
Loss-of-function allele. Loopy movement with increased reversals. |
ZM10113 |
twk-40(bln282[twk-40::TagRFP::ZF]) III; hpIs727. |
hpIs727 [rig-3p::zif-1::sl2::RFP + ttx-3p::GFP]. twk-40(bln282) is a CRISPR generated tagged allele of endogenous twk-40 locus inserting TagRFP and a ZIF-1 directed degron to the endogenous TWK-40, allowing visualization of endogenous protein expression and localization as well as targeted degradation. The presence of hpIs727 in the background leads to specific degradation of TWK-40 from AVA, causing loopy forward and reversal movement compared to twk-40(bln282) alone. |
ZM10755 |
hpIs814. |
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. Slow forward and backward movement, with reduced reversals. |
ZM11082 |
twk-40(hp834) III; hpIs814. |
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. twk-40(hp834) is a loss-of-function allele. twk-40(hp834) itself is highly loopy and a weak backward coiler. The presence of hpIs814 in the background reduces body bending and speed compared to twk-40(hp834) alone. |
ZM11086 |
hpEx4362. |
hpEx4362 [flp-18p::cha-1(sense) + twk-40p::cha-1(antisense) + ttx-3p::GFP]. Pick animals with GFP expression in AIY to maintain. Transgenic animals exhibit reduced forward speed and body bending; this phenotype is not fully penetrate. |
ZM11039 |
hpEx4351. |
hpEx4351 [npr-4p::ins-22::GFP]. Pick animals with green fluorescence in VNC to maintain. Additional GFP expression in coelomocytes. |
ZM11084 |
hpEx4363. |
hpEx4363 [npr-4p::ins-22::pHluorin + myo-2p::wCherry]. Pick wCherry+ (pharynx) animals to maintain. |
ZM11085 |
hpIs814; hpEx4363. |
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. hpEx4363 [npr-4p::ins-22::pHluorin + myo-2p::wCherry]. Pick wCherry+ (pharynx) animals to maintain. Red fluorescence in AVA. |
ZM10040 |
hpIs721. |
hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. Transgenic animals have pharyngeal RFP expression and SNB-1::GFP expression in AVA (soma and along the VNC). |
ZM10786 |
hpIs721; hpIs811. |
hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. hpIs811 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::Cherry + twk-40p(short)::Cre]. Transgenic animals have pharyngeal RFP signal; GFP puncta are visible in AVA soma but not along the VNC; RFP signals along AVA neurite. |
ZM11151 |
hpIs758; hpIs814. |
hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40p(short)::Cre + myo-2p::wCherry]. hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. RFP positive in AVA soma and neurite along the VNC. Weak pharyngeal RFP. Flat and slow movement without ATR or LED stimulation. Chrimson activation induces loopy reversal but not loopy forward after 5min. |
ZM9354 |
hpIs636. |
hpIs636 [rig-3p::HisCl1::SL2::mCherry]. mCherry expression in AVA soma and neurites along VNC. Non-specific mCherry expression in gut. HisCl activation leads to reduced forward and reversal activity. |
ZM11286 |
hpIs636; hpEx4479. |
hpIs636 [rig-3p::HisCl1::SL2::mCherry]. hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. Synapse exocytosis marker in AVA. Transgenic animals exhibit punctate green fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background. mCherry and HisCl1 expression in AVA soma and neurites. In the presence of histamine, the SNB-1::pHluorin intensity will decrease in neurites. |
ZM11284 |
twk-40(bln336) III; hpEx4479. |
hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(bln336) is a gain-of-function allele. Paralyzed; no backward movement upon head touch. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with weaker expression than in a wild-type background. |
ZM11285 |
twk-40(hp834) III; hpEx4479. |
hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(hp834) is a loss-of-function allele. Loopy. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background. |
ZM10806 |
hpIs824. |
hpIs824 [flp-18p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA soma and neurites of the VNC. Activation of gtACR2 inhibits both forward and backward movement. |
ZM10538 |
hpIs774; hpEx4081. |
hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4081 [rig-3p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre + myo-2p::RFP]. Pick RFP+ (pharynx) to maintain. Transgenic animals are GFP and RFP positive in multiple neurons in the head, but strong RFP signals in AVA neurite. Superficially wild type. Activation of gtACR2 decreases AVA and AVB’s calcium signals. hpEx4081 can be maintained by picking animals with weak pharyngeal RFP signals (seems to be a common artifact of the Cre-LoxP system). |
ZM10942 |
lin-15B&lin-15A(n765) X; hpIs774; hpEx4292. |
hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4292 [pdf-1p::LoxP::eBFP::LoxP::gtACR2::Cherry + twk-40p(short)::Cre + lin-15(+)]. Pick non-Muv to maintain. Red and green fluorescence in multiple head neurons. Activation of gtACR2 reduces AVB signals but does not generate specific changes in AVA. |
ZM10767 |
hpIs819. |
hpIs819 [twk-40p(short)::GCaMP::T2A::NLS::mNeptune + lin-15(+)]. Cytoplasmic GFP and nuclear RFP in AVA, AVE, AVB and some neurons in RVG, and tail (DVA). |