Species Information: C. elegans

Name C. elegans

C. elegans strains available at the CGC

Strain Genotype Description
RG3334 skr-15(ve834[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 474 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGCTGCTGCTCCAATCGCCGAAGAAGCCA ; Right flanking sequence: AGGCATCTGCAACTTCTGCTGATACAACTG. sgRNA #1: GCTGTAGTAGACGACTGGGG; sgRNA #2: GTTTGGCAAGGAGAAGACCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
OH17055 ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otDf1 X; otIs790. otIs790 [UPN::npp-9::mCherry::blrp::3xflag]. otIs790 contains a pan-neuronal INTACT tag for pull-down of all neuronal nuclei. CUT sextuple-mutant background. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
AMP100 ieSi57 II; rpb-2(cer135[rpb-2::GFP(delta)piRNA::AID*::3xFLAG]) III. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. cer135 is a rpb-2::GFP(delta)piRNA::AID*::3xFLAG tag inserted into the endogenous rpb-2 locus. This strain allows auxin-dependent disruption of RNA polymerase II with dose-dependent lifespan shortening. Reference: Oswal N, et al. PLoS Comput Biol. 2022 Sep 30;18(9):e1010415. PMID: 36178967.
RAF2181 ieSi57 II; daf-2(bch-40[AID*::3xFLAG::STOP::SL2::SV40::AID*::wrmScarlet::egl-13NLS]) unc-119(ed3) III. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.
ERC82 ieSi57 II; ers54[dpy-27::AID*::GFP] III. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID*::GFP tag inserted into the endogenous dpy-27 locus. Dumpy, Him, X chromosome dosage compensation hypomorph. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
ERC83 ieSi57 ers55[top-2::AID*::GFP] II. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into the endogenous top-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
ERC84 top-1(ers56[top-1::AID*::GFP]) I; ieSi57 II. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted at the end of exon five in the endogenous top-1 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
GL390 aco-2(rf40[aco-2::GFP]) III. C-terminal GFP tag inserted into endogenous aco-2 locus. ACO-2::GFP is a mitochondrial marker allowing the examination of native mitochondrial morphology in live animals. Reference: Begelman DV, et al. 2022 Jul 17;2022:10.17912/micropub.biology.000599. doi: 10.17912/micropub.biology.000599. eCollection 2022. PMID: 35903774
MC805 tars-1(gc52) II. gc52 mutants are hypoxia-resistant and have a reduced translation rate. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MC814 rtcb-1(gc50) I. gc50 mutants are hypoxia-resistant. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MC817 ddx-52(gc51) I. Temperature-sensitive: can be maintained at 20C, larval arrest (L3) at 25C. gc51 mutants are hypoxia-resistant. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MC818 xpo-3(gc59) IV. gc59 mutants are hypoxia-resistant. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MC894 ulp-4(gc54) II. Suppresses hypoxia resistance of ddx-52(gc51). gc54 and gc55 are both missense alleles of ulp-4, but may behave somewhat differently. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MC895 ulp-4(gc55) II. Suppresses hypoxia resistance of ddx-52(gc51). gc54 and gc55 are both missense alleles of ulp-4, but may behave somewhat differently. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MC896 nol-10(gc58) IV. Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MC907 aatf-1(gc63 gc64) I. Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). gc63 gc64 occurred in the same mutagenesis; unclear which allele (or if both) is causing the gain of function. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
BV70 unc-119(ed3) III; zbIs2. zbIs2 [pie-1p::lifeact::RFP::pie-1 3' UTR + unc-119(+)]. Lifeact tag labels F-actin without interfering F-actin dynmics. The strain has never been officially published; however, a GFP version of this transgene is described in Pohl C & Bao Z. Dev Cell. 2010 Sep 14;19(3):402-12. PMID: 20833362.
PHX2658 flp-1(syb2658[flp-1::T2A::3XNLS::GFP]) IV. GFP tag inserted at the C-terminus of the endogenous flp-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Taylor SR, et al. Cell. 2021 Aug 5;184(16):4329-4347.e23. doi: 10.1016/j.cell.2021.06.023. PMID: 34237253.
PHX4440 npr-37(syb4440[npr-37::SL2::GFP::H2B]) IV. GFP tag inserted at the C-terminus of the endogenous npr-37 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313.
DQM1035 bmdSi284 I. bmdSi284 [loxN::rpl-28p::TIR1(F79G)::T2A::DHB::2xmKate2] I. bmdSi284 is a single copy CRISPR/Cas9 insertion that ubiquitously co-expresses the mutant version of TIR1 for improved auxin-inducible degradation via 5-Ph-IAA and a CDK activity sensor consisting of a fragment of human DNA helicase B (DHB) fused to two copies of mKate2. Reference: Martinez MAQ, et al. Biology Open. 2022 Dec 15;11(12):bio059668. doi: 10.1242/bio.059668.
OH15623 otIs706. otIs706 [nlp-12p::TagRFP]. DVA neurons are labeled with TagRFP. Can be used to isolate DVA by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
NC4059 pha-1(e2123) III; wdEx1201. wdEx1201 [spe-27p::tagRFP + pha-1(+)]. Maintain at 25C to select for array. RMF neurons are labeled with TagRFP. Can be used to isolate RMF by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
IZ1458 ufIs126 V. ufIs126 [flp-13p::acr-12::GFP + lgc-11::mCherry] V. ACR-12::GFP expression labels postsynaptic iAChRs in DD motor neurons. References: Philbrook A, et al. eLife. 2018 Jul 24;7:e35692. doi: 10.7554/eLife.35692. PMID: 30039797. Oliver D, et al. PLoS Genet. 2022 Jan 28;18(1):e1010016. doi: 10.1371/journal.pgen.1010016. PMID: 35089924. Alexander K, et al. bioRxiv 2022.10.21.512874; doi: https://doi.org/10.1101/2022.10.21.512874.
RG3336 C33A12.3(ve836[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 1844 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATATATTGGAAATTTCTAAATTTAAAGCCA ; Right flanking sequence: TGGTCGGTTTGTACCATATTCCACATGACT. C33A12.3 sgRNA #1: GGGCTGGGCACTATTGACAC; C33A12.3 sgRNA #2: TGACGATCTCGAGAAAGCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3337 vha-18(ve837[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 1469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTCAGCAGACGCATCATTGCTTCTTTACCA ; Right flanking sequence: TTTGAAACTGAATCAAAGAAAATTAACTTT. vha-18 sgRNA #1: CTTAAAGTGGAACAACTCGG; vha-18 sgRNA #2: CAGTTTCAAAATGGTATTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
JK6268 qSi380 IV. qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3’utr::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem–loops in its 3′UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The gfp reporter RNA has three functional boxB stem–loops in its 3′UTR; the mCherry reporter 3′UTR has three mutated boxB stem–loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
RG3335 nep-6(ve835[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 3709 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTCTGCGAAAGATAAGCTGGCCAATCCT ; Right flanking sequence: ATATGCCACAATTTGCGACAGCATTCAACT. nep-6 sgRNA #1: AACACGACTAGAGCAATCAG; nep-6 sgRNA #2: TGGAAAAGATCCCATTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3338 C25G4.2(ve838[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 673 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GCTCTCTCATAAATCCGGCAATCTTCTCCT ; Right flanking sequence: AGGCAGAGGATCCGGAGTTTCGGTTGGGAA. C25G4.2 sgRNA #1: ACCGTCGATGTCAAAGCACA; C25G4.2 sgRNA #2: CGCATTGTCGATATCCGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3339 ptrg-1(ve839[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 3983 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCGATTTTCACCTTCGAGGCAAAAATACCA ; Right flanking sequence: GAACTGAAACTGAAAATCGAAGAATTGGTC. ptp-4 sgRNA #1: TCGTATACCGAAATTCAGTG; ptp-4 sgRNA #2: GCACCGTTTCTGATAACACA. ptrg-1 formerly known as ptp-4. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3327 T06E6.1(ve827[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Homozygous early larval arrest. Deletion of 1416 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+  arrested larvae (ve827 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+.  Left flanking Sequence: CGTCGGATGATTTTTTCGCCCTTTTCACCG; Right flanking sequence: AGGTAATCTCATCGCTTTTCGGGTCAAGGG. T06E6.1 sgRNA #1: CGTGTGGGGAGTGATGGAAC; T06E6.1 sgRNA #2: CTCGTCATTCCAGATCATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3328 nsun-1(ve828[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/lin-42(tmIs1226) II. tmIs1266 [myo-2p::mCherry, II: lin-42] II. Homozygous larval arrest. Deletion of 1509 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+  arrested larvae (ve828 homozygotes) and mCherry+ animals [lin-42(tmIs1226) homozygotes]. Maintain by picking wild-type GFP+ mCherry+. Note: recombination is possible and should be evident by the presence of non-fluorescent animals that are neither GFP+ nor mCherry+. Note from parent strain FX30266: Egl phenotype of lin-42 is not detectable. Left flanking Sequence: CAAAAACTGATTTTTCTGAAATCTAGTCCG; Right flanking sequence: GAGTACACGAGATATCCTGGAAAATTAGAT. nsun-1 sgRNA #1: ATGACGGTTTCAATACGGTA; nsun-1 sgRNA #2: CACGTGCTCTGTACTCGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3332 skpo-2(ve832[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Embryonic lethal. Deletion of 3081 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry dead eggs (ve832 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+.  Left flanking Sequence: GTGGGGAAAGATGCTAGACGGCTAGCTCCT; Right flanking sequence: AGGTCGTGGCGATCTTTGCAGGATTTGCTG. skpo-2 sgRNA #1: GGACTACAATGCCTGGAAAG; skpo-2 sgRNA #2: TCGAGGACCAGAATTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
MH4920 unc-119(ed3) III; kuIs102. kuIs102 [vgln-1p::vgln-1::GFP + Cbr-unc-119(+)]. Integrated translational VGLN-1::GFP fusion protein. Reference: Zabinsky RA, et al. G3 (Bethesda). 2017 Jun 2. pii: g3.117.043414. doi: 10.1534/g3.117.043414. PMID: 28576776
WHY10 glh-1(how3[3xHA::TurboID::glh-1]) I. 3xHA::TurboID tag inserted at the N-terminus of the endogenous GLH-1. TurboID::GLH-1 promiscuously labels proteins at 20C. Transgene generated in N2 background. Reference: Price I, et al. ELife. 2021 Nov 3;10:e72276. doi: 10.7554/eLife.72276.
OH16111 unc-42(ot986[unc-42::gfp]) V. GFP tag inserted at the C-terminus of the endogenous unc-42 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Berghoff EG, et al. Elife. 2021 Jun 24;10:e64903. doi: 10.7554/eLife.64903. PMID: 34165428
PHX4523 frpr-19(syb4523[frpr19::SL2::GFP::H2B]) IV. GFP tag inserted at the C-terminus of the endogenous frpr-19 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
PHX4399 nlp-82(syb4399[nlp-82::SL2::GFP::H2B]) II. GFP tag inserted at the C-terminus of the endogenous nlp-82 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3306 nlp-62(syb3306[nlp-62::T2A::3XNLS::GFP]) I. GFP tag inserted at the C-terminus of the endogenous nlp-62 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX2634 flp-3(syb2634[flp-3::T2A::3XNLS::GFP]) X. GFP tag inserted at the C-terminus of the endogenous flp-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Tekieli T. et al. Development. 2021 Sep 15;148(18):dev199687. doi: 10.1242/dev.199687. PMID: 34415309.
KAB34 louIs2. louIs2 [ges-1p::mCherry::GFP::SKL::unc-54 3' UTR]. Expresses a mCherry::GFP::serine-lysine-leucine peroxisome signal sequence (SKL) fluorescent pexophagy reporter in the C. elegans intestine. Generated in N2 background. Reference: Dolese DA, et al. Autophagy. 2022 Jul;18(7):1522-1533. https://doi.org/10.1080/15548627.2021.1990647 PMID: 34689720
CZ27190 juIs550. juIs550 [mec-4p::mito::GCaMP5 + ttx-3p::RFP]. Mitochondrial calcium reporter expressed in touch neurons. Reference: Tang NH, et al. Curr Biol. 2020 Mar 9;30(5):865-876.e7. doi: 10.1016/j.cub.2019.12.061. PMID: 31983639
HAL94 gtf-2H5(tm6360) III. Deletion allele generated by the Mitani Lab.
HAL240 gtf-2H5(emcSi73[gtf-2H5-1::AID*::GFP]) III. CRISPR/Cas9-engineered insertion of AID*::GFP tags into C-terminus of endogenous gtf-2H5 locus allowing auxin-induced degradation.
HAL504 gtf-2H1(emcSi202[AID*::GFP::gtf-2H1]) IV. CRISPR/Cas9-engineered insertion of AID*::GFP tags into N-terminus of endogenous gtf-2H1 locus allowing auxin-induced degradation.
UN1502 xbIs1502. xbIs1502 [act-1::GFP + rol-6(su1006)]. GFP-labeled actin in the spermatheca. Reference: Wirshing ACE &, Cram EJ. Mol Biol Cell. 2017 Jul 7;28(14):1937-1949. doi: 10.1091/mbc.E17-01-0029. PMID: 28331075
MQD2798 vit-2(crg9070[vit-2::gfp]) vit-1(hq503[vit-1::mCherry]) X. mCherry knocked into C terminal of vit-1 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.
MQD2775 vit-3(hq485[vit-3::mCherry]) vit-2(crg9070[vit-2::gfp]) X. mCherry knocked into C terminal of vit-3 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.
MQD2774 vit-6(hq486[vit-6::mCherry]) IV; vit-2(crg9070[vit-2::gfp]) X. mCherry knocked into C terminal of vit-6 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.
XE2374 casy-1(wp60) II; oyIs14 V. oyIs14 [sra-6::GFP + lin-15(+)] V. wp60 is an allele of casy-1, the C. elegans homolog of calsyntenin. Reference: Ding C, et al. eLife. 2022 Mar 14;11:e73557. doi: 10.7554/eLife.73557. PMID: 35285800.
OC306 ttll-4(tm3310) III. Phenotypically wild-type for brood size, viability, Dyf and male mating efficiency. Strain OC306 is identical to OC422: the same out-crossed stock was frozen down twice in lab stocks. Reference: Chawla DG, et al. Biol Open. 2016 Sep 15;5(9):1290-8. doi: 10.1242/bio.017442. PMID: 27635036