| ZM11020 |
ljIs131; hpEx4343. |
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4343 [acr-5p::TeTx::wCherry + unc-4p::TeTx::wCherry + HygromycinR]. Pick animals with wCherry expression in ventral cord neurons to maintain hpEx4343. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Animals carrying hpEx4343 rest as coilers strongly biased towards ventral bend as L1 larvae and are severely Unc as adults. Coiling is somewhat suppressed in the ljIs131 background, but animals still exhibit an obvious bias towards ventral bend during movement. Hygromycin can be used to select for hpEx4343 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701. |
| ZM10281 |
hpIs740. |
hpIs740 [twk-40(s)p::GCaMP6s::wScarlet + lin-15(+)]. GCaMP and RFP expression in AVA, AVB, AVE and DVA. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM7419 |
hpIs363. |
hpIs363 [sra-11p::ChR2::YFP + ttx-3p::RFP]. YFP expression in AVA. RFP expression in AIY. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| KDK53250 |
oskEx53250. |
oskEx53250 [dat-1p::GCaMP6f + dat-1p::mCherry + lin-44p::mRFP + N2 genomic DNA cut with Pvu II (as a carrier)]. Pick animals with red fluorescence to maintain. GCaMP6f and mCherry expressed in dopaminergic neurons. Generated in N2 background. Reference: Tanimoto Y, et al. Sci Rep. 2016 May 19;6:26297. doi: 10.1038/srep26297. PMID: 27193056. |
| OH16377 |
ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otIs356 V; otDf1 X. |
otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. CUT Sextuple mutant animals show reduced pan-neuronal gene expression, impaired locomotion and resistance to aldicarb induced paralysis. otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341. |
| HT1361 |
lpIs32. |
lpIs32 [ftt-2::gfp + rol-6]. Rollers. FTT-2::GFP is expressed strongly in the pharynx, and can be observed in the neurons in the head, body and tail, and also weakly expressed in the intestine. Reference: Wang Y, et al. Mech Ageing Dev. 2006 Sep;127(9):741-7. PMID: 16860373. |
| OH18011 |
pha-1(e2123) III; otEx7947. |
otEx7947 [W02A2.5p::GFP + pha-1(+)]. I3 neurons are labeled with GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
| OH18043 |
rab-3(ot1178 syb3072) II; him-8(e1489) IV. |
CRISPR-engineered mutation of CUT transcription factor binding site in endogenously-tagged rab-3(syb3072[rab-3::T2A::3xNLS::GFP]). Causes a reduction in rab-3 expression. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 |
| JK6673 |
fzr-1(q1290[3xV5::fzr-1]) II. |
Endogenous fzr-1 locus tagged with 3xV5 close to the N-terminus. Insertion site is a few amino acids downstream of start site (...PAN-3xV5-SPA…). Primer sequences to validate the strain: slc316 GCTTTTGCGTGTTCTCCTCA, slc317 TGAATCCTGAGTCATCATCCGAGT, WT product 347 bp, q1290[3xV5::fzr-1] product 485 bp. |
| PHX5400 |
golg-5(syb5400[golg-5::wrmScarlet]) I. |
wrmScarlet tag inserted at the C-terminus of the endogenous golg-5 locus by CRISPR. Broad punctate expression. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6325 |
unc-13(syb6325[unc-13::SL2::GFP::H2B) I. |
GFP tag inserted at the C-terminus of the endogenous unc-13 locus by CRISPR. Nuclear neuronal and hypodermal expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6123 |
T07A9.10(syb6123[T07A9.10::SL2::GFP::H2B) IV. |
GFP tag inserted at the C-terminus of the endogenous T07A9.10 locus by CRISPR. Punctate ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6153 |
latd-1(syb6153[latd-1::GFP) X. |
C39D10.6. GFP tag inserted at the C-terminus of the endogenous latd-1 locus by CRISPR. Punctate GFP expression in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6394 |
Y71G12B.26(syb6394[Y71G12B.26::GFP]) I. |
GFP tag inserted at the C-terminus of the endogenous Y71G12B.26 locus by CRISPR. Expression of GFP in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6345 |
W02D7.3(syb6345[GFP::W02D7.3]) V. |
GFP tag inserted at the N-terminus of the endogenous W02D7.3 locus by CRISPR. Expression of GFP in pharynx, excretory gland cell, and some additional cells in the head. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6304 |
syx-3(syb6304[syx-3::SL2::GFP::H2B]) X. |
GFP tag inserted at the C-terminus of the endogenous syx-3 locus by CRISPR. Ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6466 |
F36D1.23(syb6466[F36D1.23::tagRFP]) I. |
tagRFP tag inserted at the C-terminus of the endogenous F36D1.23 locus by CRISPR. Strong and specific expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX6541 |
spex-2(syb6541[spex-2::SL2::GFP]) I. |
GFP tag inserted at the C-terminus of the endogenous spex-2/F36D1.7 locus by CRISPR. Expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5859 |
ceh-48(syb5859[flag::NLS::Cre::SL2::ceh-48]) IV. |
Cre inserted into the endogenous ceh-48 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5804 |
egl-3(syb5804[flag::NLS::Cre::SL2::egl-3]) V. |
Cre inserted into the endogenous egl-3 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX5755 |
pha-4(syb5755[pha-4::3xGAS::GFP::3xGAS::AID*::TEV::LoxP::3xFLAG] *ot1078 *ot946) V. |
Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID* after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain. |
| WF2183 |
cwEx417. |
cwEx417 [cfz-2p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Generated in N2 background. |
| WF2516 |
mnp-1(gm85) III. |
Unc. Sma. Reference: Craft TR & Forrester WC. Dev Biol.2017 Apr 1;424(1):18-27. PMID: 28238735 |
| WF2575 |
cwEx486. |
cwEx486 [mnp-1p::mnp-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. Generated in N2 background. |
| WF1863 |
cam-1(gm122); cwEx266. |
cwEx266 [cam-1p::cam-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. Unc. GFP-tagged CAM-1 rescues gm122. Generated in N2 background. |
| PHX2880 |
ceh-16(syb2709[loxP] syb2880[ceh-16::loxP::GFP]) III. |
GFP tag inserted at the C-terminus of the endogenous ceh-16 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX3936 |
nlp-51(syb3936[nlp-51::SL2::GFP::H2B]) II. |
GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933. |
| PHX4413 |
flp-27(syb4413 [flp-27::SL2::GFP::H2B]) II. |
GFP tag inserted at the C-terminus of the endogenous flp-27 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933. |
| PHX4406 |
nlp-73(syb4406 [nlp-73::SL2::GFP::H2B]) V. |
GFP tag inserted at the C-terminus of the endogenous nlp-73 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX4678 |
ceh-30(syb4678[ceh-30::GFP]) X. |
GFP tag inserted at the C-terminus of the endogenous ceh-30 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| OH18108 |
otIs669 V; nlp-66(syb4403[nlp-66:SL2:GFP::H2B])X. |
GFP tag inserted at the C-terminus of the endogenous nlp-66 locus by CRISPR. Allele generated by SUNY Biotech. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX3203 |
flp-6 (syb3203 [flp-6::T2A::3XNLS::GFP]) V. |
GFP tag inserted at the C-terminus of the endogenous flp-6 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
| PHX5536 |
ins-9(syb5536[ins-9::SL2::gfp::H2B]) X. |
GFP tag inserted at the C-terminus of the endogenous ins-9 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX4517 |
nmur-2(syb4517 [nmur-2::SL2::GFP::H2B)] II. |
GFP tag inserted at the C-terminus of the endogenous nmur-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX3277 |
flp-13 (syb3277 [flp-13::T2A::3XNLS::GFP]) IV. |
GFP tag inserted at the C-terminus of the endogenous flp-13 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX4433 |
npr-32 (syb4433 [npr-32::SL2::GFP::H2B] IV. |
GFP tag inserted at the C-terminus of the endogenous npr-32 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX3241 |
flp-20 (syb3241 [flp-20::T2A::3xNLS::GFP]) X. |
GFP tag inserted at the C-terminus of the endogenous flp-20 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX2805 |
nlp-51(syb2805 [nlp-51::T2A::3xNLS::GFP]) II. |
GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Taylor SR, et al. Cell. 2021 Aug 5;184(16):4329-4347.e23. doi: 10.1016/j.cell.2021.06.023. PMID: 34237253. |
| PHX3191 |
nlp-58(syb3191 [nlp-58::T2A::3xNLS::GFP]) V. |
GFP tag inserted at the C-terminus of the endogenous nlp-58 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX4442 |
dmsr-6 (syb4442 [dmsr-6::SL2::GFP::H2B]) I. |
GFP tag inserted at the C-terminus of the endogenous dmsr-6 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| PHX4595 |
tkr-1 (syb4595 [tkr-1::SL2::GFP::H2B]) III. |
GFP tag inserted at the C-terminus of the endogenous tkr-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
| LX2404 |
vsSi39 II; unc-119(ed3) III. |
vsSi39 [goa-1-gfp(Q205L) + unc-119(+)] II. Single-copy mosSCI insertion of the gain-of-function goa-1(Q205L)::GFP translational fusion driven by 5kb of the goa-1 promoter. Animals have shallow body bends and are egg-laying defective. Reference: Kumar S, et al. G3 (Bethesda). 2021 Aug 7;11(8):jkab167. doi: 10.1093/g3journal/jkab167. PMID: 34003969 |
| PHX2605 |
ceh-13(syb2605[ceh-13::GFP]) III. |
GFP tag inserted at the C-terminus of the endogenous ceh-13 locus by CRISPR. Reference: Murray JI, et al. PLOS Genet. 2022 May 2;18(5):e1010187. PMID: 35500030 |
| PHX2679 |
nob-1(syb2679[nob-1::GFP]) III. |
GFP tag inserted at the C-terminus of the endogenous nob-1 locus by CRISPR. Reference: Murray JI, et al. PLOS Genet. 2022 May 2;18(5):e1010187. PMID: 35500030 |
| PHX5791 |
pop-1(syb5791[GFP::AID*::GGGGSGSGS linker::pop-1]) I. |
GFP and AID* tags inserted at the N-terminus of the endogenous pop-1 locus by CRISPR. Insertion includes a GGGGSGSGS linker sequence between the tags and POP-1. Generated in N2 background. |
| SXB15 |
prdx-2(gch1[prdx-2::GFP + unc-119(+)] II. |
Maintain at 20C or warmer. GFP tag inserted at the C-terminus of the endogenous prdx-2 locus by CRISPR. Small broods; contains Ste animals, and occasional Pvl. A cold-sensitive mortal germline phenotype has been observed ( at 15°) which could not be eliminated after outcrossing. Reference: Quentin S, et al. PLoS One. 2022 Sep 29;17(9):e0274226. PMID: 36173997 |
| SXB63 |
unc-119(ed3) III; gur-3(gch16[gur-3::GFP + unc-119(+)]) X. |
GFP tag inserted at the C-terminus of the endogenous gur-3 locus by CRISPR. Reference: Quentin S, et al. PLoS One. 2022 Sep 29;17(9):e0274226. PMID: 36173997 |
| SXB34 |
trx-1(gch9[trx-1::GFP + unc-119(+)] II; unc-119(ed3) III. |
GFP tag inserted at the C-terminus of the endogenous trx-1 locus by CRISPR. Reference: Quintin S and Charvin G, 2022 micropublication Biology |
| PHX3285 |
nlp-54(syb3285 [nlp-54::T2A::3xNLS::GFP]) IV. |
GFP tag inserted at the C-terminus of the endogenous nlp-54 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain. |
| PHX4049 |
flp-20(syb4049[flp-20::SL2::GFP::H2B]) X. |
GFP tag inserted at the C-terminus of the endogenous flp-20 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195. |
