| VH7022 |
ctf-18(hd7009[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VH7025 |
F28H1.4(hd7025[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous viable. Deletion of 3045 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAGTTGGGTGAAAAAGATCTTGCGAATTA; Right flanking sequence: AGGGAACTGTTCGAGAAAAAATGGGACAAG. sgRNA #1: GAGGGTGATACGTACATGTA; sgRNA #2: AAGAAAATGGGGAAACACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VH7026 |
lbp-5(hd7016[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCTGATAATAAAACTTTCTTCAAATGCG; Right flanking sequence: GGCGGGCAACAAGGTTAAACGATGGCCAAT. sgRNA #1: AACTTTCTTCAAATGCGAGT; sgRNA #2: TTTAACGTGGAAGAGATGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VH7028 |
F33D11.1(hd7023[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous viable. Deletion of 515 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGAATCAAGCCCCAGTTGGCAGTCATTT; Right flanking sequence: TGGGATCTTCAACTTCGGATGATTGTTTGC. sgRNA #1: CATACAATGCCACACACGCG; sgRNA #2: GTGTTCATTCCGATTGTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VH7030 |
F43C1.7(hd7013[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. |
Homozygous viable. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGATAAAAATTAGGTATTTCAGGTTTTCCA; Right flanking sequence: GGGTTACTGTAGACGAAATGAATCCGAAAA. sgRNA #1: AACAACTTGAAGGAACTCAA; sgRNA #2: CATAAATATTAAAGCCGGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| PHX893 |
nish-1(syb767) IV. |
Shorter body length. Reference: Bennett DF, et al. Aging Cell. 2023 Feb;22(2):e13774. doi: 10.1111/acel.13774. PMID: 36670049. |
| JH3867 |
bqSi189 II; npp-10(ax4538[mNeonGreen::npp-10]) III. |
bqSi189 [lmn-1p::mCherry::his-58::pie-1 3'utr] II. mNeonGreen is inserted at the N-terminus of the endogenous npp-10 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH3938 |
bqSi189 II; npp-9(ax4540[mNeonGreen::npp-9]) III. |
bqSi189 [lmn-1p::mCherry::his-58::pie-1 3'utr] II. mNeonGreen is inserted at the N-terminus of the endogenous npp-9 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH4201 |
npp-11(ax4547[npp-11::wrmScarlet]) I. |
wrmScarlet is inserted at the C-terminus of the endogenous npp-11 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH3906 |
ran-2(ax4545[ran-2::wrmScarlet]) III. |
wrmScarlet is inserted at the C-terminus of the endogenous ran-2 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH4202 |
npp-22(ax4549[npp-22::wrmScarlet]) V. |
wrmScarlet is inserted at the C-terminus of the endogenous npp-22 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH3872 |
npp-14(ax4548[npp-14::OLLAS]) I. |
OLLAS is inserted at the C-terminus of the endogenous npp-14 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH3955 |
bqSi189 II; xpo-1(ax4542[xpo-1::mNeonGreen]) V. |
bqSi189 [lmn-1p::mCherry::his-58::pie-1 3'utr] II. mNeonGreen is inserted at the C-terminus of the endogenous xpo-1 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH3886 |
npp-14(ax4543) I. |
ax4523 is a deletion residues 24-1387 of the npp-14 coding region. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH4012 |
gtbp-1(ax4561[gtbp-1p::IBB domain::mNeonGreen::gtbp-1 3'utr]) IV. |
The Importin Beta Binding domain (IBB)::mNeonGreen reporter replaces gtbp-1 in the endogenous gtbp-1 locus. Sterile at 25C; maintain at 20C. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH3904 |
tdp-1(ax4546[tdp-1::wrmScarlet]) II. |
wrmScarlet is inserted at the C-terminus of the endogenous tdp-1 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| ZM11177 |
hpIs860. |
hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA). |
| ZM11207 |
twk-40(bln336) III; hpIs860. |
hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. twk-40 gain-of-function allele. Paralyzed, no backward movement upon head touch. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA). |
| ZM11208 |
twk-40(hp834) III; hpIs860. |
hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. Loopy movement with increased reversals. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA). |
| ZM8302 |
twk-40(hp834) III. |
Loss-of-function allele. Loopy movement with increased reversals. |
| ZM10113 |
twk-40(bln282[twk-40::TagRFP::ZF1]) III; hpIs727. |
hpIs727 [rig-3p::zif-1::sl2::RFP + ttx-3p::GFP]. twk-40(bln282) is a CRISPR generated allele of the endogenous twk-40 locus, inserting TagRFP and ZF1 allowing visualization of endogenous protein expression and localization as well as ZIF-1-mediated degradation. hpIs727 provides AVA neuron-specific expression of ZIF-1, leading to depletion of TWK-40 from AVA. Animals have loopy forward and reversal movements compared to twk-40(bln282) alone. |
| ZM10755 |
hpIs814. |
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. Slow forward and backward movement, with reduced reversals. |
| ZM11082 |
twk-40(hp834) III; hpIs814. |
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. twk-40(hp834) is a loss-of-function allele. twk-40(hp834) itself is highly loopy and a weak backward coiler. The presence of hpIs814 in the background reduces body bending and speed compared to twk-40(hp834) alone. |
| ZM11086 |
hpEx4362. |
hpEx4362 [flp-18p::cha-1(sense) + twk-40p::cha-1(antisense) + ttx-3p::GFP]. Pick animals with GFP expression in AIY to maintain. Transgenic animals exhibit reduced forward speed and body bending; this phenotype is not fully penetrate. |
| ZM11039 |
hpEx4351. |
hpEx4351 [npr-4p::ins-22::GFP]. Pick animals with green fluorescence in VNC to maintain. Additional GFP expression in coelomocytes. |
| ZM11084 |
hpEx4363. |
hpEx4363 [npr-4p::ins-22::pHluorin + myo-2p::wCherry]. Pick wCherry+ (pharynx) animals to maintain. |
| ZM11085 |
hpIs814; hpEx4363. |
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. hpEx4363 [npr-4p::ins-22::pHluorin + myo-2p::wCherry]. Pick wCherry+ (pharynx) animals to maintain. Red fluorescence in AVA. |
| ZM10040 |
hpIs721. |
hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. Transgenic animals have pharyngeal RFP expression and SNB-1::GFP expression in AVA (soma and along the VNC). |
| ZM10786 |
hpIs721; hpIs811. |
hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. hpIs811 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::Cherry + twk-40p(short)::Cre]. Transgenic animals have pharyngeal RFP signal; GFP puncta are visible in AVA soma but not along the VNC; RFP signals along AVA neurite. |
| ZM11151 |
hpIs758; hpIs814. |
hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40p(short)::Cre + myo-2p::wCherry]. hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. RFP positive in AVA soma and neurite along the VNC. Weak pharyngeal RFP. Flat and slow movement without ATR or LED stimulation. Chrimson activation induces loopy reversal but not loopy forward after 5min. |
| ZM9354 |
hpIs636. |
hpIs636 [rig-3p::HisCl1::SL2::mCherry]. mCherry expression in AVA soma and neurites along VNC. Non-specific mCherry expression in gut. HisCl activation leads to reduced forward and reversal activity. |
| ZM11286 |
hpIs636; hpEx4479. |
hpIs636 [rig-3p::HisCl1::SL2::mCherry]. hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. Synapse exocytosis marker in AVA. Transgenic animals exhibit punctate green fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background. mCherry and HisCl1 expression in AVA soma and neurites. In the presence of histamine, the SNB-1::pHluorin intensity will decrease in neurites. |
| ZM11284 |
twk-40(bln336) III; hpEx4479. |
hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(bln336) is a gain-of-function allele. Paralyzed; no backward movement upon head touch. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with weaker expression than in a wild-type background. |
| ZM11285 |
twk-40(hp834) III; hpEx4479. |
hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(hp834) is a loss-of-function allele. Loopy. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background. |
| ZM10806 |
hpIs824. |
hpIs824 [flp-18p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA soma and neurites of the VNC. Activation of gtACR2 inhibits both forward and backward movement. |
| ZM10538 |
hpIs774; hpEx4081. |
hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4081 [rig-3p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre + myo-2p::RFP]. Pick RFP+ (pharynx) to maintain. Transgenic animals are GFP and RFP positive in multiple neurons in the head, but strong RFP signals in AVA neurite. Superficially wild type. Activation of gtACR2 decreases AVA and AVB’s calcium signals. hpEx4081 can be maintained by picking animals with weak pharyngeal RFP signals (seems to be a common artifact of the Cre-LoxP system). |
| ZM10942 |
lin-15B&lin-15A(n765) X; hpIs774; hpEx4292. |
hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4292 [pdf-1p::LoxP::eBFP::LoxP::gtACR2::Cherry + twk-40p(short)::Cre + lin-15(+)]. Pick non-Muv to maintain. Red and green fluorescence in multiple head neurons. Activation of gtACR2 reduces AVB signals but does not generate specific changes in AVA. |
| ZM10767 |
hpIs819. |
hpIs819 [twk-40p(short)::GCaMP::T2A::NLS::mNeptune + lin-15(+)]. Cytoplasmic GFP and nuclear RFP in AVA, AVE, AVB and some neurons in RVG, and tail (DVA). |
| ZM11034 |
hpIs819; hpIs810. |
hpIs819 [twk-40p(short)::GCaMP::T2A::NLS::mNeptune + lin-15(+)]. hpIs810 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Transgenic animals exhibit strong RFP signals in AVA soma and neurites; cytoplasmic GFP and RFP in AVA, AVE, AVB and some neurons in RVG and tail (DVA). |
| XE2031 |
wpIs107 I. |
wpIs107 [F49C12.10p::GFP] I. GFP expression in CAN neurons can be used to isolate CAN by FACS. F49C12.10 also known as nemt-1. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
| OH16144 |
nIs175 IV. |
nIs175 [ceh-28p::4xNLS::GFP + lin-15(+)] IV. GFP expression in M4 neurons can be used to isolate M4 by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
| OH18353 |
pha-1(e2123) III; otEx8029. |
otEx8029 [ceh-19(prom 2)::GFP + pha-1(+)]. Maintain 25C to select for array. Modified ceh-19 promoter fragment drives bright expression of GFP in MC L/R. There is also expression in an additional unidentified cell in the tail but this expression is much much dimmer and typically not visible under the dissecting scope. GFP expression in MC can be used to isolate MC by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
| CER323 |
ubh-4(cer27) II. |
Reduced brood size. Genetic interaction with rpn-9. cer27 is a 1033 bp deletion removing the start codon and nearly all of the ubh-4 coding sequence. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270 |
| CER250 |
ubh-4(cer25[F73V]) II. |
Superficially wild-type. ubh-4(cer25[F73V]) is a missense mutation mimicking a human BAP1 cancer mutation. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270 |
| CER344 |
ubh-4(cer32[A87D]) II. |
Superficially wild-type. ubh-4(cer32[A87D]) is a missense mutation mimicking a human BAP1 cancer mutation. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270 |
| CER620 |
ubh-4(cer68[ubh-4::eGFP]) rpn-9(cer203[rpn-9::wrmScarlet]) II |
eGFP tag inserted into endogenous ubh-4 locus. wrmScarlet tag inserted into endogenous rpn-9 locus. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270 |
| CER522 |
ubh-4(cer140) rpn-9(gk401)/mIn1 [mIs14 dpy-10(e128)] II. |
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270 |
| RG3356 |
C46H3.2(ve856[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. |
Homozygous viable. Deletion of 6859 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTCTAAAACATTTCAATTCTAACCTTGCA ; Right flanking sequence: TGCTTCAACACCACAAAAGTCCTCAACTGC. C46H3.2 sgRNA #1: TGATCATCGGATAACAATGG; C46H3.2 sgRNA #2: AACGAGCTGAGCTTATCGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| NM5879 |
jsSi1900 II. |
jsSi1900 [loxP::cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207 |
| NM5922 |
jsSi1944 II. |
jsSi1944 [loxP::mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207 |
