Laboratory Information

NameRG View on WormBase
Allele designationve
HeadAnn E Rougvie
InstitutionUniversity of Minnesota
Address 6-160 Jackson Hall
321 Church St SE
Minneapolis 55455
United States
Gene classes tim 

Strains contributed by this laboratory

Strain Genotype Species Description
CGC120 mir-792(umn31[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR Lox511I + Lox2272]) V. C. elegans mir-792 pre-miRNA deletion strain deletion allele in which mir-792 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC158 mir-61&mir-250(umn65[mir-61p::SL1::EGL-13NLS::lox2272::::mScarlet-I::cMycNLS:: lox511I sqt-1(d) hsp::CRE HygR Lox511I::let-858 3'UTR::lox2722]) II. C. elegans mScarlet replacement of mir-61 and mir-250 pre-miRNAs.
CGC159 mir-61&mir-250(umn66[mir-61p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722]) II. C. elegans mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed
CGC160 mir-61&mir-250(umn67[mir-61p::SL1::EGL13NLS::lox2272]) II. C. elegans mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC and mScarlet-I have been removed
CGC161 mir-266(umn68[mir-266p::SL1::EGL13NLS::lox2272)] X. C. elegans Deletion of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC162 mir-266(umn69[mir-266p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. C. elegans mScarlet replacement of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC163 mir-271(umn70[mir-271p::SL1::EGL13NLS::lox2272)] X. C. elegans Deletion of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC164 mir-271(umn71[mir-271p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. C. elegans mScarlet replacement of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC165 mir-784(umn72[mir-784p::SL1::EGL13NLS::lox2272]) X. C. elegans Deletion of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC166 mir-784(umn73[mir-784p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. C. elegans mScarlet replacement of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC167 mir-787(umn74[mir-787p::SL1::EGL13NLS::lox2272]) X. C. elegans Deletion of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC168 mir-787(umn75[mir-787p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. C. elegans mScarlet replacement of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC58 C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC59 gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C.elegans Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC61 F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC72 npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC73 npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC78 C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC81 C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
E Arlltaektrvub Acraea encedon Dolcu ug um bece win haupepi jefma pizolwel duh po er runepa etodasca tarumelug cesar. Zop bohdo ji laj ijisamaj oz sofbak ga biab cizuz va wiz zos weow gutopo. Logejo oni usezeffij toeplur pizi duzeli wulwigta zefapupi ufezu himuse tukanor mudviad tez ekoromi je.
E1 Arlltaektrvub C. elegans Dolcu ug um bece win haupepi jefma pizolwel duh po er runepa etodasca tarumelug cesar. Zop bohdo ji laj ijisamaj oz sofbak ga biab cizuz va wiz zos weow gutopo. Logejo oni usezeffij toeplur pizi duzeli wulwigta zefapupi ufezu himuse tukanor mudviad tez ekoromi je.
E2 Arlltaektrvub C. elegans Dolcu ug um bece win haupepi jefma pizolwel duh po er runepa etodasca tarumelug cesar. Zop bohdo ji laj ijisamaj oz sofbak ga biab cizuz va wiz zos weow gutopo. Logejo oni usezeffij toeplur pizi duzeli wulwigta zefapupi ufezu himuse tukanor mudviad tez ekoromi je.
GR1395 mgIs49 IV. C. elegans mgIs49 [mlt-10p::GFP::PEST + ttx-3::GFP] IV. GFP expression oscillates with molting cycle. Reference: Veli SM, et al. Mol Biol Cell. 2010 May 15;21(10):1648-61. PMID: 20335506.
JR1000 ced-1(e1735) I; unc-119(ed4) III; wIs78 IV. C. elegans wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)] IV. GFP expression in seam cells and adherens junctions. ajm-1 previously called jam-1.
MT5790 lin-4(e912) II; nIs2 IV. C. elegans nIs2 [lin-11::lacZ + lin-11(+)] IV. Vul. Integrated on IV near dpy-20.
RG1228 daf-9(rh50) X. C. elegans Hypomorphic allele. Temperature-sensitve Daf-c. Maintain at 15 C. Reference: Gerisch B, Antebi A. Development. 2004 Apr;131(8):1765-76.
RG1860 Not publically available. C. elegans Not publically available.
RG1861 Not publically available. C. elegans Not publically available.
RG1862 Not publically available. C. elegans Not publically available.
RG1863 Not publically available. C. elegans Not publically available.
RG229 Cephalobus sp. Cephalobus sp. Cephalobidae family. Cephalobus sp. Isolated by Susan Euling from soil near a roadway in Pontianak, Borneo, Indonesia in December 1994. Family and genus identification by Lynn Carta.
RG3000 sra-34(ve500[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3001 sra-36(ve501[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acggcatttactcacagaaaatgggaatat ; Right flanking sequence: cgcttcaaagtttgtaatttgaaatttgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3002 sra-1(ve502[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3003 sra-3(ve503[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cagcgtgagaaaaatatcagaatgtgatcg ; Right flanking sequence: gtgggagattctatcaagagaattcactga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3004 sra-4(ve504[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3005 Y65B4BL.1(ve505[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans unc, dpy, rol, slight egl, pvl. Deletion of 1258 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tatccaatatcctacatcctatatcctcgt ; Right flanking sequence: attggaaaaatacgagacgatcgatgaaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3006 sra-31(ve506[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3007 sra-28(ve507[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 3237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aggaaaattaaatttcaattttcttgttcc ; Right flanking sequence: ggaggtgttagcttttaaaatatgactggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3008 sra-29(ve508[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1279 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agtattcactctttgttgtctttaccgaca ; Right flanking sequence: GCAAAAGGTTTTTGGTACAAAATGGAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3009 sra-20(ve509[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1413 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGTCGAAAGCTTAAGATGCGCTTCCGAAG ; Right flanking sequence: ctatcaatcctccttctttattttatcatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3010 sra-18(ve510[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAATTGTGCTTCGGAAAGTCTCACCAATG ; Right flanking sequence: gtggggctcgacgtcaaggttttatttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3011 sra-17(ve511[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3012 sra-27(ve512(LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3013 sra-22(ve513[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1577 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaccgtcaacgctatcattaatttcatcc ; Right flanking sequence: gaaggcgaggcaagacgatttttctgtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3014 sra-37(ve514[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 2317 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaataaTTATACTGACGCGTATTTGCTG ; Right flanking sequence: CATtatggtctcatgaagtgctgctggaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3015 sra-12(ve515[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTATTAGTGGAGCCAGAGAAACACAGGCA ; Right flanking sequence: CACGGGTACTTATTAATGGATAACACGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3016 sra-26(ve516[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1961 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGTTTCATATGAGAATCCAGATCTCCATA ; Right flanking sequence: GTTCAGTAGTTTTATTCATtttgtgcttaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3017 sra-9(ve517[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcagtttcaagatttcATGGCTACCATAG ; Right flanking sequence: ataggctgaaccaaaaaagtacatcgagtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3018 sra-39(ve518[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 2040 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC ; Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3019 sra-32(ve519[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtcaaatatgttccagtttttataccactc ; Right flanking sequence: ggtggttttgattattaatgggagcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3020 sra-24(ve520[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1150 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGAAGGTCTCACCAATGCATTGACCTCGA ; Right flanking sequence: CTTGGCGTTAATTATTTGAGAATATTCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3021 sra-33(ve521[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 2545 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcatcaaaatTCATTTATTCCACAT ; Right flanking sequence: gcacaaataatatgtgaaaaggggaacctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3022 sra-21(ve522[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1748 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagagcagaaaccacacatctgctcacaga ; Right flanking sequence: tctggactgttattgaaagttttacgggtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3023 sra-30(ve523[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctgaaacagtaaattattaactaacCTGAA ; Right flanking sequence: TGAATTCATTGCCTCGAGAATTCCAGAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3024 sra-38(ve524[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 1918 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATAGCAATGATGAAAACATTAGTGGCATA ; Right flanking sequence: GGTGGTGATAGAGAAGTCCGTTTGACTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3025 sra-25(ve525[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 1944 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTGTGTTTGGTGAATTCCGTTTTCCACCA ; Right flanking sequence: atgacaatttctggatttttgggtacatct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3026 sra-7(ve526[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1486 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tttcacagtccgttgacttttgatgcaatt ; Right flanking sequence: ACAGGATTCGTTCTTCACATGTTAGCCGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3027 C40H5.2(ve527[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 1675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccaggcaatgatcaacgATGTACGCCTTAT ; Right flanking sequence: TCTGGAAGATCTTGAAGACTCTGCCATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3028 C40H5.7(ve528[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT ; Right flanking sequence: atcacatgtcatatacagtattccattaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3029 C34C6.3(ve529[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1562 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aatgattttcagttcagATGCCTTCCTCTG ; Right flanking sequence: TATGGAACACAACAAGATGGTAGATCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3030 C46F4.3(ve530[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 794 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG ; Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3031 F53C11.9(ve531[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 349 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattctcattgagaacatttcaacacacaa ; Right flanking sequence: CAAGGATTTGTTGTTGATTCAAATACCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3032 igeg-1(ve532[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 2773 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTTGGTCTTTCGATCCAATAACGTTGAA ; Right flanking sequence: AACGGAACATCAGATTCAAAACTGCTCGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3033 igeg-2(ve533[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTTAATAGTTGTCGTCGAGTACTTGGAGT ; Right flanking sequence: TGTGGTTCCCGTGTGTGTTCCTTcttaaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3034 +/nT1[umnIs49] IV; C37C3.7(ve534[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, Mig. Deletion of 1217 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste Mig GFP+ non-mKate2 (ve534 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GAAGTCGATGCCGTTCTGCAGTATCCTTCA ; Right flanking sequence: TACAATGACAAATCCCTCCAGCATAGATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3035 nas-17(ve535[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 1433 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATCACTTCGACATGTTTCTTCGACCATCT ; Right flanking sequence: TACGGAAGCAGCAAGTTGACAATTCATTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3036 irg-7(ve536[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 5265 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA ; Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3037 Y65B4BL.6(ve537[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 1682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggctataaaacgacggaaaaagaaataaaa ; Right flanking sequence: ggcggtgaagccgtgtgtgtgtgtgtggct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3038 C26D10.3(ve538[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1301 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tctcgagtaattcgtatcctgcgaataaat ; Right flanking sequence: CAAGGAGAAGTGTGTGGAAGAGCGATGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3039 F40F11.4(ve539[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, lays only oocytes. Deletion of 2632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate2 (ve539 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcacaaaaactcacAAATAACTTTGTACCG ; Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAATACATA. sgRNA #1: acAAATAACTTTGTACCGGG; sgRNA #2: CTTCATAGCTCTTGCGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3040 +/nT1 [umnIs49] IV; F58H1.6(ve540[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste with a few escapers. Deletion of 1527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Sterile GFP+ non-mKate2 (ve540 homozygotes, some escapers will lay broods), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aagtccgagataaataatctacatcctcat ; Right flanking sequence: TATCCAAGAAACACAGATTGGGATTGCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3041 K06A9.3(ve541[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtcagaatcacaaaaaattatgttttttt ; Right flanking sequence: GGAGGGGCACATAGAATCAATCATGCGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3042 +/mT1[umnIs52] II; cee-1(ve542[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 1124 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste Pvl GFP+ non-mKate2 (ve542 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: GTTTTATGATGCTCTTCAATTCTACCGGAC ; Right flanking sequence: GCTGGTGCACCGGCTCCAGCTCCAGTTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3043 T12A7.2(ve543[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 2862 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tttttgtaagtaaatttgaaatacccggta ; Right flanking sequence: tgaggaaaagaaatattgattaggcgtatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3044 +/mT1[umnIs52] II; rpn-3(ve544[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous arrest at larval stage. Deletion of 1779 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (ve544 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: ttcaaattttaaagggaaATGGCTCCGAAA ; Right flanking sequence: ccgaatgaattttataaggatgaattgcat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3045 Y38C1AA.9(ve545[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 1665 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: gtaattgctcataaagatataaaaccccTT ; Right flanking sequence: CAATCACGTGCACTTTTTCGGCATGAATCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3046 C46G7.1(ve546[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 1523 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, larval lethal GFP+ non-mKate2 (ve546 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caatacaatttacaggtaaaagccggcaac ; Right flanking sequence: ATCGGAATTGCAGTTCTTCTTTCACTTCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3047 +/mT1[umnIs52] II; K12H4.5(ve547[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous lethal. Deletion of 418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal GFP+ non-mKate2 (ve547 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaattaattaatttataatgtgatcctttt ; Right flanking sequence: agtcgtagacgattttcgattttcactgta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3048 M03F4.6(ve548[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC30[ubc-17(tmIs1243)] X. C. elegans tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous lethal. Deletion of 2153 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, arrested GFP+ non-mCherry (ve548 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: TTTGACTTGTTTGTACCCGCATCTACATTG ; Right flanking sequence: ATCGGGAGTTTCTGCACACTGAGTTCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3049 K07E1.1(ve549[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 979 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tattttctcctgctttcagttttgatttcc ; Right flanking sequence: ccatctgtcttgtaaatagagctctcttca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3050 T01D1.4(ve550[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1770 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttgtctgatgtagaagtttagttgttgtgg ; Right flanking sequence: TGTGGGAGACGACGATCTCCGCATGGGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3051 decr-1.3(ve551[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1260 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCTTCCACGAATAACGTTCTCAACATCTCC ; Right flanking sequence: cgtggaacaccctttttaatctttaaactt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3052 tdo-2(ve552[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. C. elegans Homozygous viable. Deletion of 2406 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: atttcaataatctCTAATCACTTTCTGATG ; Right flanking sequence: tgtgtaggcatcttatttcaaggaaacaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3053 fbp-1(ve553[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 4852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCCTCGACGTCGAGTTTCGATCCGAGAATG ; Right flanking sequence: CCATttctgtaagaatttattgaattttga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3054 sue-1(ve554[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 10676 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaattttgtgggaataaacgcacaccgcga ; Right flanking sequence: caaggtgaaaaagaaaacaaatagttactg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3055 rpl-4(ve555[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous lethal, heterozygous animals might grow slower than wild-type. Deletion of 1188 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type mKate2+GFP+, and segregate wild-type mKate2+GFP+, arrested GFP+ non-mKate2 (rpl-4 homozygotes), arrested non-GFP mKate2+ (hT1 homozygotes), and dead eggs. Maintain by picking wild-type mKate2+ and GFP+. Left flanking Sequence: ATTTCTTCACGTTGGCCTTTGAAGCCTTGC ; Right flanking sequence: Ttattacctgcaatcaacagaaatagtaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3056 B0464.6(ve556[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. C.elegans Homozygous viable. Deletion of 2168 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: GTTTCACAAAATGAATAAATTGAGCGATAG ; Right flanking sequence: TGATGCCTGTGATGTGTTGAGTAATGAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3057 mrpl-41(ve557[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ II. C. elegans Unbalanced heterozygote. Homozygous lethal, arrests at late larval stage with a few escapers that become sterile adults. Pick viable fertile GFP+ animals to maintain. Deletion of 1032 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: ACTGGTGCTCGTAAGCACTCGTGGAGTCCG ; Right flanking sequence: TGTTCAAATCGAAAAGCGACGAGTTGCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3058 C01G6.5(ve558[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable, Egl. Deletion of 3209 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: ttccacataagatcttaaaatacagaaata ; Right flanking sequence: ggtgggaaaaacagaagaaaagcatgtcgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3059 C04F5.8(ve559[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. C. elegans Homozygous viable. Deletion of 2256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: CCGAGTCCCCGTGAGCTCTCGAATCCCGTA ; Right flanking sequence: atgggttactgtagcgcttgtatcgattta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3060 B0261.1(ve560[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous Let. Deletion of 4055 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve560 homozygotes),  non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: AATGCACAATTTGCATCTCCAAATCCGCCA ; Right flanking sequence: ccgttattttacgactgtcaaatctccatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3061 +/mT1[umnIs52] II; algn-11(ve561[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Lvl. Deletion of 2578 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, arrested GFP+ non-mKate2 larvae (ve561 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: cgatcagtttgaaatccataggaaagtttc ; Right flanking sequence: GAATCCAGAATAAAGGCTGAATGGTATAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3062 C05C8.7(ve562[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Emb. Deletion of 3553 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (ve562 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: attgaaaaaagtgttggtattaccccgtaa ; Right flanking sequence: TATGGTGTCTTCTGATCAATTTGGAAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3063 sucl-1(ve563[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. C. elegans Homozygous viable. Deletion of 1669 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: tatttcatttaaatcaccttatttgtattt ; Right flanking sequence: TGGCCACCGCTTTCCTGGGAAAGATCTAAa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3064 skr-17(ve564[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. C. elegans Homozygous viable. Deletion of 718 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: agggtgttttaaaatttgaatttgccgccg ; Right flanking sequence: ATGGGATGATTAAttttctgttactatctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3065 +/nT1 [umnIs49] IV; nol-56(ve565[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Lvl. Deletion of 2013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve574 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs.  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tgcgcaaaactgtacCTTCTCCTTAACCTC ; Right flanking sequence: Tggtgtaagaacctgaaaaatcatttattc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3066 snpc-1.1(ve566[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Lvl. Deletion of 2013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve566 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ animals. Left flanking Sequence: agattaataaaataacaaaagtcggagatg ; Right flanking sequence: gcgggaaccagcggtattcaacgcatttca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3067 +/hT1 [umnIs58] I; erfa-1(ve567[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 2016 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve567 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: cagcacaaatagaatATGAGCGCTCCCGCA ; Right flanking sequence: GGTGGATGTTTCTACTCGCAATTCCAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3068 C25A1.16(ve568[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous Lvl. Deletion of 477 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve568 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TTTCACCCCCAATAAACCTATCAATTATCA ; Right flanking sequence: tcaggtttaaattagatttcttcgaatttg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3069 C25H3.14(ve569[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. C. elegans Homozygous viable. Deletion of 920 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cgagtactctgtacatgttttgatggtaag ; Right flanking sequence: ACTGGAGTCCACACCAAGGCGTTCCCAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3070 C25H3.3(ve570[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. C. elegans Homozygous viable. Deletion of 1006 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gccgcattttggacccaagatttcgcgtct ; Right flanking sequence: acaatttctaatttgatcgttttgaaaaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3071 mlt-2(ve571[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; + /hT1 [unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous Let. Deletion of 2897 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve571 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gttttcattaaatcaaaatttgtgccacca ; Right flanking sequence: GCAAACCGTCGATctttaagattgtaacat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3072 C06E4.6(ve572[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. C. elegans Homozygous viable. Deletion of 1065 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: gagatcaaatacttcttccaagtTTACTGG ; Right flanking sequence: tttaaagtaacaagataggcagacataccc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3073 C25D7.16(ve573[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. C. elegans Homozygous viable. Deletion of 323 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGTTCAACAATCGATTGAAATTCGTGTTA ; Right flanking sequence: ACCGGCGTTCAGACAGTCTCCACAAAGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3074 +/nT1 [umnIs49] IV; mcm-3(ve574[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste. Deletion of 2846 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate adults (ve574 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tagtacaataggcaatgtaaaatcaatgtg ; Right flanking sequence: cggggaaaatagaaaaattcggcccaaatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3075 C25E10.16(ve575[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. C. elegans Homozygous viable. Deletion of 1085 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: taaggtagcaccatcgaaaaaaaacctcat ; Right flanking sequence: tgtgggttggtatggagaattggagacgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3076 anat-1(ve576[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. C. elegans Homozygous viable. Deletion of 9928 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtctctttctattttaccttctttccggca ; Right flanking sequence: tgtcccaatttcacattattatatattttg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3077 +/mT1[umnIs52] II; bcas-2(ve577[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 944 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Pvul GFP+ non-mKate2 adults (ve577 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaatccaaaaTCAGTTCTCCTGATCCTCTT ; Right flanking sequence: GTAAGTGCTAACGGTTTGGAGCTCATcacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3078 +/szT1 [lon-2(e678) umnIs61] I; bcat-1(ve578[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. C. elegans umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Homozygous Let. Deletion of 2704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve578 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttaacacccgtatcattatcatttccatgc ; Right flanking sequence: cccaacttccttccaccccctcaaaaagcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3079 bmy-1(ve579[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mIn1[dpy-10(e128) umnIs43] II. C. elegans umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Mel. Deletion of 694 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 that give dead progeny (ve579 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ataatgtttcgcaatgctctcctttcctac ; Right flanking sequence: GAAGGACAGAGCTTTGACGGACCTGCGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3080 cchl-1(ve580[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mIn1[dpy-10(e128) umnIs43] II. C. elegans umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 1136 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve580 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ttattaggcttatggagcggtgggtaaatt ; Right flanking sequence: cacggaaatgatgaaactagagaaaaaagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3081 clx-1(ve581[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. C. elegans Homozygous viable. Deletion of 2495 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atgggaatgttgtggaactttgaatctatg ; Right flanking sequence: gtttttcgccattttgattcgggttcgact. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3082 cope-1(ve582[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. C. elegans Homozygous viable. Deletion of 1274 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaagtccgcaatattacattgcgcgtgaag ; Right flanking sequence: CATGGGTTATCGATTTCAATGAGAAGGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3083 copz-1(ve583[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. C. elegans umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Emb. Deletion of 898 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead eggs (ve579 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atcggctcgtaaatctacacgaaaacctag ; Right flanking sequence: CACAAATCGGCTTCTCGTTCATGAAATCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3084 C25D7.1(ve584[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. C. elegans Homozygous viable. Deletion of 584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: tacaagtattctggaaaaaagccgaaccaa ; Right flanking sequence: tgcaaaaatatcttacCTCTGGATCAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3085 mrpl-34(ve585[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve585 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: ttatcaaactctcatttttagATGCCATCG ; Right flanking sequence: GTCGGCGACGGAATATATTCTTCAAAATCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3086 +/hT1 [umnIs58] I; cmd-1(ve586[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 1416 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve586 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gattttttctctctcgtcaccgtttcaccc ; Right flanking sequence: acctgtaaaaccccataaaaaaatttaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3087 dad-1(ve587[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; + /hT1 [unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 699 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve587 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gtgtaacacagcaagagaaacgaaacccca ; Right flanking sequence: TTTGGTAGTCATCGAACAGTTTCGAGAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3088 ddp-1(ve588[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. C. elegans umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygotes have small broods that never mature. Deletion of 401 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 have small broods that never mature (ve588 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatctatagtttttctcacaggaaATGGA; Right flanking sequence: ttaggctcttttccataaattttcccttaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3089 dgtr-1(ve589[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 1566 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate that give dead eggs (ve589 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gaactacggtcaaaatcgttgcgagaccct ; Right flanking sequence: GACACTCATCTCATCTTCCAGTGActtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3090 dhps-1(ve590[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Ste. Deletion of 4636 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+, Sterile GFP+ non-mKate2 (ve566 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttttcagaaacttgctccaaaATGAGCAC ; Right flanking sequence: agGAGTCGTAAAACACCACATCAACAACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3091 +/nT1 [umnIs49] IV; dlst-1(ve591[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1803 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate larvae (ve591 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaattaaaaattttgtgaaagcatgaccaa ; Right flanking sequence: TCTGGAAAGAAACCGATGAACTGATACTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3092 hoe-1(ve592[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest with occassional escapers. Deletion of 3396 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate larvae with occasional escapers (ve592 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaaagtaacaatgaactaaaaacgtgaata ; Right flanking sequence: TTGATTGTCGCAGATTTGAGATGCTTGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3093 +/nT1[umnIs49] IV; eif-2Bdelta(ve593[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 4255 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve593 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: taccattacttctcatgtatgtacccgccg ; Right flanking sequence: gccctctaactgtttctttttgttctgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3094 +/mT1[umnIs52] II; F10E9.5(ve594[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate2 larvae (ve594 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny.  Left flanking Sequence: AGCAACATACAGATGCATCACGTCAAGgta ; Right flanking sequence: CTCTGGCCTAATATTCCATTCAGATTTTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3095 F17H10.1(ve595[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 4865 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcactctgtccgcgtttctttgaccgcat ; Right flanking sequence: tagcctcgtaatgtagcagatacccaaaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3096 F18A1.7(ve596[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1089 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acatatttgtgtcgggtgattatttacaat ; Right flanking sequence: aggtcatataaggaaaagaacagctaggta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3097 F20A1.1(ve597[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 544 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: actaatcaccactacgtgtcgtcacaattc ; Right flanking sequence: aagactacagtaacgggtgaaatatcgaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3098 F20A1.10(ve598[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atgtatatatgtgcatttcgagcaacaaca ; Right flanking sequence: cggtttttatacatccaaattgagatcggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3099 F21D5.1(ve599[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 2044 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate adults (ve599 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatttttttcagaaATGGATCTCACTGTT ; Right flanking sequence: cataatctcccaaagttttttttaaatttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3100 icmt-1(ve600[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 1396 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gattattataaaaagcgtgaaaacgtgaaa ; Right flanking sequence: tggaaaaacaaatagttacgcattatttcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3101 F11A10.5(ve601[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 2313 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tggcacgtcaccaacaaccaccaaccggct ; Right flanking sequence: ttgtactcttccttccaaacttcgtgttcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3102 elo-2(ve602[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous unhealthy. Deletion of 1650 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sickly animals that can grow up to lay small broods (ve602 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: accgggaaaaatgtgaaattgcgaaactag ; Right flanking sequence: ggagggcaaagtgtattttttaaatgattt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3103 +/mT1[umnIs52] II; aco-2(ve603[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 3465 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve603 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaataggttctatttctttccctttgtcgg ; Right flanking sequence: tgagattgtttttatgtatgagtagatatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3104 cwc-15(ve604[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. C. elegans Homozygous larval arrest. Deletion of 1421 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ clear young larvae easiest to see at the edge of the lawn (ve604 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: aactcatattcaaaactcgcgccgaaatgt ; Right flanking sequence: gtaggccgtatcgacttttcaagtactttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3105 nduf-6(ve605[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous late larval arrest. Deletion of 560 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve605 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gctcttttatattgaattcaaagttgtatc ; Right flanking sequence: tggttttattttttagtatgtatacaaaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3106 rpa-1(ve606[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1[dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 2554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve606 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttctacgccattttttttggcgcgtatccg ; Right flanking sequence: atccacaatcgctgattttgtacaatgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3107 rpb-12(ve607[loxP+myo2-p::GFP+NeoR+loxP])/nT1[umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 437 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve607 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gaagatcaagtatgaaatttaaaattcaac ; Right flanking sequence: ttgttaatgaaatgcgaaacgataaatttt. rpb-12 sgRNA #1: ggctgaacctgtatcatttt; rpb-12 sgRNA #2: ttaaagatattcagaATGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3108 F11G11.5(ve608[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 956 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acgttttcagatttctagaaATGACCGGTC ; Right flanking sequence: tcctaccaagtagacatattaactgttcca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3109 F23F1.5(ve609[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sqt-2(sc3) II. C. elegans Homozygous sterile. Deletion of 1538 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygous adults are Rol GFP+, and segregate Rol GFP+ adults, non-Rol GFP+ sterile adults (ve609 homozygotes) and non-Rol non-GFP adults (sc3 homozygotes). Maintain by picking Rol GFP+ adults.
RG3110 rpt-4(ve610[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sqt-2(sc3) II. C. elegans Homozygous larval arrest. Deletion of 1568 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygous adults are Rol GFP+, and segregate Rol GFP+ adults, non-Rol GFP+ ve610 homozygotes (larval arrest) and non-Rol non-GFP adults (sc3 homozygotes). Maintain by picking Rol GFP+ adults. Left flanking Sequence: aaaaattactataatatttcgcgatttttt ; Right flanking sequence: aggaaagaacgtcagaaatgaaaatcagaa. rpt-4 sgRNA #1: ttacgaggctcgtcattatt; rpt-4 sgRNA #2: gaaaaaacgaggttctcatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3111 F56C11.5(ve611[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous Mel. Deletion of 3345 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 adults that lay dead eggs (ve611 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: GATCAATCGCTGGTCCAGAAGGTTCCACTA ; Right flanking sequence: TCAGGCCACCGATTTTTAGtctatatttta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3112 gcsh-2(ve612[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous sterile. Deletion of 773 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve612 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: CATACTGTTCCTCGTTAAGAAGTTTTTCCA ; Right flanking sequence: agggcaatgattgtcttggagttttttttg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3113 col-133(ve613[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 3100 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggagtacacggaagaagatgcaatgataaa ; Right flanking sequence: gatcgtagcgagacccactctgaaaaaccg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3114 col-154(ve614[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 1367 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aagagggaggatgaacagcgggcggtgcca ; Right flanking sequence: acattttgaaaaaaaagctcgagaacgagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3115 vha-11(ve615[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25[unc-5(tm9708)]. C. elegans Homozygous Emb. Deletion of 5698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP unc-5(tm9708) homozygotes, and GFP+ dead embryos(ve615).
RG3116 +/mT1[umnIs52] II; rpl-23(ve616[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 483 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve616 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaacaacagcTTAAGCGATGGATCCAGCG ; Right flanking sequence: CGTCCTCTCTTCGACATtttacctgaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3117 +/mT1[umnIs52] II; dars-1(ve617[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 1747 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve617 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ATGGTAACTCGCTCAAGTCCGATGCCTCCT ; Right flanking sequence: TGGAGAGTTTTGGTTGTTCACCTTCGGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3118 col-155(ve618[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 1138 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gaaattctgaatcatatatttttcaatcat ; Right flanking sequence: gtattgcaattacacttggcagatgcaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3119 +/mT1[umnIs52] II; cpf-2(ve619[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 1981 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve619 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TTTCTCTTCAACTGCTGTCTCAGCTCTATT ; Right flanking sequence: tagctccacccacattttttgtgacgtcac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3120 F52G2.3(ve620[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 7573 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atgtttttccagttgctcacggtaccttca ; Right flanking sequence: gcgggtttggtgcggtttttacgtattcag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3121 F53A3.7(ve621[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. C. elegans umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous Sterile. Deletion of 465 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve621 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: agggtttctaaatatcttttaaaacctttg ; Right flanking sequence: AACGTCGTGACACGATAAAGAACGAGAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3122 F53B7.7(ve622[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 511 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gaaaaaagtgcaacgtgcggaattccctaa ; Right flanking sequence: GATACACTTATTCACACATACTATCCAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3123 veDf1 [LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP] IV. C. elegans Homozygous viable. Deficiency of 4040 bp, removes his-55, his-56, his-58 and his-57, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaacgtggtactgtaatcgttgcgagacct ; Right flanking sequence: actgtttaattttaaaagcgtctataacgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3124 +/nT1[umnIs49] IV; isy-1(ve624[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1033 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve624 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GACGAATAGTCATTGGTCGTCCATCCTCTC ; Right flanking sequence: attggcggttattcaaattcaatattttac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3125 +/mT1[umnIs52] II; prx-19(ve625[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 1698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 most are sterile adults, but escapers do lay small broods (ve625 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tggaaaataactgaggacacttattgctac ; Right flanking sequence: tttggatcgataaaacacacaatcggtgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3126 ints-11(ve626[LoxxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. C. elegans umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous arrested larvae. Deletion of 2171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve626 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny.
RG3127 rpt-5(ve627[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Larval lethal w/ escapers that show pleiotropic phenotypes. Deletion of 1521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae with occasional escapers (ve627 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gattcaaagggaacacagtgacaaccggga ; Right flanking sequence: tctggggcctgaaaattagttgtaattgct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3128 +/mT1[umnIs52] II; vha-14(ve628[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 1453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve628 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atgtttttttcatagaaataacaaactttt ; Right flanking sequence: caccctccgatgttcttcctgttttctatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3129 clec-178(ve629[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans homozygous viable. Deletion of 954 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacttacgcaataggtatattccctaaa ; Right flanking sequence: gtaggataggttttactgtcagaagcttcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3130 col-157(ve630[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans homozygous viable. Deletion of 1753 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: attttgatgattcctcttgcaaatccagac ; Right flanking sequence: gttggcaaaaaaacaatattttttcctgat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3131 ears-2(ve631[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) /dpy-9(e12) IV. C. elegans Homozygous sterile, Pvl. Deletion of 1629 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ non-Dpy Pvl sterile adults (ve631 homozygotes), Dpy non-GFP (dpy-9(e12) homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: acaatggaaatcggagTTATAATAATTCCT ; Right flanking sequence: CGGTTAGCTTCATaatttctattgaggggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3132 erh-1(ve632[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans homozygous viable. Deletion of 566 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggaaagagatagaagtgagaaacccatatg ; Right flanking sequence: tttggtgttcgggcaatttttatttttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3133 fndc-1(ve633[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans homozygous viable. Deletion of 641 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgaagaaaaaaatagacagcatgactagac ; Right flanking sequence: gctggaacaatcacagtactacattactcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3134 czw-1(ve634[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC5 IV. C. elegans Homozygous larval arrest. Deletion of 3125 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ non-Mec non-Unc arrested larvae (ve634 homozygotes) and non-GFP Mec Unc animals (tmC5 homozygotes). Maintain by picking wild-type GFP+.
RG3135 +/mT1[umnIs52] II; F54C8.1(ve635[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve635 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGCAAAGTGTGCCATGCAAAACATCAGAAA ; Right flanking sequence: GTAGATAAGCTGGTTGCCGAGGGAAAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3136 +/mT1[umnIs52] II; F54C8.4(ve636[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1778 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve636 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaagatcaaaagttgaacagggagaacat ; Right flanking sequence: gggacttgaattttcggagaaagaagacgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3137 +/nT1[umnIs49] IV; cct-7(ve637[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 2891 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve637 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caagATGATGCGCCCACCAATTATCCTGCT ; Right flanking sequence: CAATAAggagatcaatgtgcccctctgtgc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3138 klp-3(ve638[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 3142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttttgtctccgttttttgcgttgttttcct ; Right flanking sequence: tccattctagtccatgaaaaatttcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3139 pigv-1(ve639[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1[umnIs58] I; +/hT1[unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous sterile. Deletion of 2451 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve639 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: tattgatctgttttctaaaatgattaatac ; Right flanking sequence: cattaattaatttccttatccgtttaacta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3140 +/hT1[umnIs58] I; T10B5.3(ve640[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1[unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval lethal. Deletion of 2913 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve640 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gatattatgatattagagagacggcgggga ; Right flanking sequence: tctggaaactgcaaaaaaatattggaaaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3141 +/mT1[umnIs52] II; popl-5(ve641[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 2064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve641 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: caatgcgcctacatgcctacctacatgcca ; Right flanking sequence: AGGCTCATTTTCAAAATAGAATATCCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3142 gtf-2E2(ve642[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1[dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 1631 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve642 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaaaaataacttgaaacttcaaaagaaata ; Right flanking sequence: TTCGCTTTTGCTGCTTCTGAAGAGTATGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3143 +/nT1 [umnIs49] IV; hpo-31(ve643[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 2300 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve641 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).
RG3144 +/mT1[umnIs52] II; T20B12.3(ve644[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 1668 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve644 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tacgcaaacatgacacctgacgacatttca ; Right flanking sequence: GTGGGAAATTCGCTCCAAAACACGAAGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3145 pfd-3(ve645[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1[unc-54(h1040)] I. C. elegans Homozygous sterile, Pvl. Deletion of 1266 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ Pvl, sterile adults (ve645 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)]) homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: cgcgtcaactggaattttctttttccccgg ; Right flanking sequence: ATCAATCTGGCTTGGAGCCAACGTAATGGT. sgRNA #1: aattgagcgtagaaattccg; sgRNA #2: CTCCAAGCCAGATTGATACc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3146 T13H5.4(ve646[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. C. elegans umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 1702 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve646 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ACAGAAGTCCTTGTCTTTTCAAATCCTCAT ; Right flanking sequence: CCTCGTGCAAGTTTCTGATGGTTTCTAGAC. sgRNA #1: GGTCACCAGGAAGATGTATG; sgRNA #2: CAGAAACTTGCACGAGGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3147 T14B4.3(ve647[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous sterile. Deletion of 1115 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve647 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaccaatgctgatgaaatcaacttccacgg ; Right flanking sequence: GATGGGTAGACAGAAGAAAGATTAGaatta. sgRNA #1: caagagaacttgaaactccg; sgRNA #2: GATCCTGGTTCGACTATCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3148 +/mT1[umnIs52] II; T20B12.7(ve648[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile, slight Dpy. Deletion of 1939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 slight Dpy sterile adults (ve648 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: acggttaattgaaaatgctccgcccccgaa ; Right flanking sequence: GTTGGGATGCTTCAAAAAGTCGGACAAAAT. sgRNA #1: cctaacgagagccatggttc; sgRNA #2: GTCCGTCACTTGAAGCAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3149 T14B4.8(ve649[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 3703 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaataaggcgatctcagaatcaaaggttc ; Right flanking sequence: ttcgcaagtttcgtgtggtcgttaaaaact. sgRNA #1: tctcagaatcaaaggttcca; sgRNA #2: cacacgaaacttgcgaaatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3150 copg-1(ve650[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC5 IV. C. elegans Homozygous embryonic lethal. Deletion of 3667 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead eggs (ve650 homozygotes) and Mec Unc animals (tmC5 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: caaatgttaaatttacattgtaaacctcgc ; Right flanking sequence: ttcgacaattgtgatgtatgtgtgttttaa. sgRNA #1: tacatacacagttggtcgcg; sgRNA #2: acatcacaattgtcgaacgc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3151 +/szT1 [lon-2(e678) umnIs61] I; T20B5.2(ve651[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. C. elegans umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Homozygotes are unhealthy. Deletion of 5228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sickly adults (ve651 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaggggagggaaaacagttgaggacttttg ; Right flanking sequence: GAATGCGCATACTTGATGGAAAACCCGCTC. sgRNA #1: aacagttgaggacttttggt; sgRNA #2: ATCAAGTATGCGCATTCGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3152 T20D3.5(ve652[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC5 IV. C. elegans Homozygous sterile. Deletion of 1274 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults(ve652 homozygotes) and Mec Unc animals (tmC5 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: gatgcaattcaacaaatcaaattggaaggc ; Right flanking sequence: aactcaccggacgtataagtctaacttgat. sgRNA #1: caaatcaaattggaaggcgt; sgRNA #2: tatacgtccggtgagttcaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3153 tni-3(ve653[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 1346 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agcacataaaaatctacaaaaagatcacca ; Right flanking sequence: cctggaaaagttgatctgtgagaagtggca. sgRNA #1: GGAGGAAGAGGAATAAgaag; sgRNA #2: tttggcggggaaaaatgacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3154 T26C5.5(ve654[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygotes are unhealthy, lay small broods. Deletion of 696 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 unhealthy animals (ve654 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcactacattgcctcCTAACATGTCCTTCC ; Right flanking sequence: gggggtttcctctttctttctttttaaaga. sgRNA #1: ATACATATTATTGGATTGGA; sgRNA #2: attgaaatggagaaggacgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3155 vps-2(ve655[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 850 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve655 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CTCTTCTAAGCTGATCAAGACGGGCCTGAA ; Right flanking sequence: AGGAAATCCATctgaaaagtggaatatttc. sgRNA #1: TGATGTTGACGATGATCTTC; sgRNA #2: tttcagATGGATTTCCTGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3156 +/nT1 [umnIs49] IV; F53F1.2(ve656[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate adults that lay dead eggs (ve656 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).
RG3157 +/nT1 [umnIs49] IV; F55A11.4(ve657[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 1849 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve657 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).
RG3158 +/mT1 [umnIs52] II; dhhc-8(ve658[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygotes are egg-laying defective, unhealthy. Deletion of 9372 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 Egl-d adults (ve658 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tgataatttaataaaacctctattccagtc ; Right flanking sequence: CGGACACCTTCCAGGACGGCGACGTCTCCA. sgRNA #1: tctgcatcagaccgaaattc; sgRNA #2: TAAATTCGAAATCCGGGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3159 ard-1(ve659[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC5 IV. C. elegans Homozygous sterile, Pvl. Deletion of 3031 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ Sterile Pvl (ve659 homozygotes) and Mec Unc animals (tmC5 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: cacttatgatttaggtaaacgggaacaaAT ; Right flanking sequence: ctccttgtactctgggatctatattcataa. sgRNA #1: aggtaaacgggaacaaATGT; sgRNA #2: tcccagagtacaaggagaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3160 T19A6.4(ve660[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 3602 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctttggaaagttattcggtttgaagagtac ; Right flanking sequence: cagtgcagtacccctttcatggaagcccta. sgRNA #1: attcggtttgaagagtacga; sgRNA #2: aaaggggtactgcactgtag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3161 Y53G8AR.6(ve661[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26]III. C. elegans qIs26 [lag-2::GFP + rol-6(su1006)]. Homozygotes are unhealthy. Deletion of 1671 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) unhealthy animals (ve661 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: aaaaatccgctagaaaccgtctaaaaacct ; Right flanking sequence: AGGCTTCACGTGCTGAAAGATTCGGAATTA. sgRNA #1: atcaatagcgtaggctttac; sgRNA #2: ACTAACATCAAATGACGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3162 Y47G6A.18(ve662[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygotes Dpy and unhealthy. Deletion of 3929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Dpy adults (ve662 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: agaagaaacaaagaaatcccaaaaaaaaaa ; Right flanking sequence: Tatccgattattacagtattaaattctatc. sgRNA #1: aagaaaaaagaaacggtata; sgRNA #2: actgtaataatcggatATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3163 Y47G6A.19(ve663[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 3949 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaaatccaaaaaaaactcacCGGCAAATA ; Right flanking sequence: GTCAGCTCGATCCGTGTCAGCTGTCTCGAA. sgRNA #1: aaaactcacCGGCAAATATT; sgRNA #2: ACACGGATCGAGCTGACTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3164 +/mT1 [umnIs52] II; Y39A1A.22(ve664[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygotes are slow growing, Mel. Deletion of 2999 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that lay dead eggs (ve664 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaacctcccgaTTAGGTGTTAGTAGTGTCG ; Right flanking sequence: ggggaacactcattgatttaaatcatgatt. sgRNA #1: ATGAAAGTAGTAGTGACGAC; sgRNA #2: gcaaaaaaacacaatctcga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3165 Y39E4B.13(ve665[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. C. elegans Homozygous viable. Deletion of 2573 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cttttttaaaaataaaatacgttattccca ; Right flanking sequence: gctacagtaacccgcgtggcgggacccaaa. sgRNA #1: atttattgtccgggaaatgt; sgRNA #2: accagtttcatctgtgtcga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3166 mek-2(ve666[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous sterile. Deletion of 4483 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults(ve666 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: tagaatcaccccctggagctggagcatcct ; Right flanking sequence: cggggcgcacggaaattgcgtgcgcaacga. sgRNA #1: ctctttgtctctcactgtct; sgRNA #2: caagggatgttcactgcgcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3167 Y54F10AM.5(ve667[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) C. elegans umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous larval arrest. Deletion of 1461 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve667 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aacttgtgtggatttacgggcaaacagccg ; Right flanking sequence: ACAATATTACTGAAAGCTAGatttctctga. sgRNA #1: ataaaatttgttttgcgcaa; sgRNA #2: AGCGCCAGTCGTTGTATTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3168 F21D5.7(ve668[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 2266 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve668 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).
RG3170 +/mT1 [umnIs52] II; uev-2(ve670[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 1228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve670 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aagatccagcttaggttcagttaacgcggc ; Right flanking sequence: tatggaatttttcagatttttctccaaaaa. sgRNA #4: GGATACTTCCATGTATCCCA; sgRNA #5: AACGTCGAATAATAGCGCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3171 +/mT1 [umnIs52] II; mlc-5(ve671[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile, Dpy. Deletion of 866 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile Dpy adults (ve671 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaggctgaatttttgcttgagaatttctg ; Right flanking sequence: ctcggcattttccacacaatctatttattt. sgRNA #1: tttgcttgagaatttctgga; sgRNA #2: atcatttccattaatttcct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3172 sumv-2(ve672[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 8389 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aatccgagacagacgcagacagtcgtacaa ; Right flanking sequence: tgggaaaaatttgagaaaaattcacggaat. sgRNA #3: tataggaatgccgttgcgcg; sgRNA #4: atgaaatttcgatgtaagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3173 Y40B1B.7(ve673[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1 C. elegans Homozygous sterile. Deletion of 1965 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults(ve673 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ggaaTCACTTGGTCACTTGTGTAGTATCAC ; Right flanking sequence: aggaatatcacgaaaaaatgcgaaatttgg. sgRNA #1: GCATTTGAATGGAGCGGAGC; sgRNA #2: ccaaaaatgcaatttcagcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3174 +/mT1 [umnIs52] II; Y43F4B.5(ve674[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 3288 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve674 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atagagaaacggcaaggtcatttacctggc ; Right flanking sequence: TCTGGAAAGTGTGATTTCTGAGATGGATCA. sgRNA #1: tgtgtggatgagaaaaggcc; sgRNA #2: GGGAAAAACGCAGAATGATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3175 Y45F10B.13(ve675[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 11717 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gaaagtgtttgttttttgttagtttctaag ; Right flanking sequence: gatccccttcttcttcttcttttcgttgta. sgRNA #1: gcttttaagtgaatacCGGT; sgRNA #2: agaagaagaaggggatccta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3176 sld-2(ve676[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous sterile, Pvl. Deletion of 918 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile, Pvl adults (ve676 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: attaaatttttaaattattttcagcccgaa ; Right flanking sequence: GCAGCCAGAAAACTCGGCGGTTCATCAAAA. sgRNA #1: TCCACTCTTCCATtacgttc; sgRNA #2: TGGATTGTAGGAACGTGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3177 T21B10.3(ve677[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous maternal effect lethal. Deletion of 4525 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adult animals that lay dead eggs (ve677 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gctcgtaacagcaaaATGAATAATCCAGAA ; Right flanking sequence: attgaattcgtatttttttccattccacat. sgRNA #1: TCTGTTACAGCGCTTTCTTC; sgRNA #2: aaaaatacgaattcaatggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3178 +/mT1 [umnIs52] II; Y39A1A.14(ve678[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest w/ a few escapers. Deletion of 1011 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve678 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aattaatttctccgaatttcagATGTCCCA ; Right flanking sequence: GGGGAATTATTTAAttgattttttgcagtt. sgRNA #1: GTGCAACTGTATCGTACTCG; sgRNA #2: CAGTGGACTTGAGGAGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3179 elof-1(ve679[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 379 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: taataattgtttttcagaaccaatccaaac ; Right flanking sequence: cgcgttgatctctttgcttttctcagtaat. sgRNA #1: TCCCATtgctgcggattgtt; sgRNA #2: gcaaagagatcaacgcgatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3180 eif-3.B(ve680[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 2917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve680 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gcgcttgcaacgacgctccgttctcccgca ; Right flanking sequence: tctccgtgttttctggtggtttttgccgat. sgRNA #1: actctaaacaacacccatgc; sgRNA #2: accagaaaacacggagagac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3181 +/mT1 [umnIs52] II; Y54H5A.1(ve681[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1630 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve681 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: GTCCGGTGAAAATGACGTTGAAATGCATGA ; Right flanking sequence: TATGGGTCAGAATGAGGTCAAAGAAGTTCA. sgRNA #1: TGACGTTGAAATGCATGATG; sgRNA #2: ACAGCTGATGTTCGTCCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3182 lips-14(ve682[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1801 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctgcgcgaagaaaaaacccaatcttcacca ; Right flanking sequence: tggctttaaatataaacgtgaaatcgaaat. sgRNA #1: gaaattgaaacaatgtcaaa; sgRNA #2: attaaatcgaaaggctcata. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3183 lips-13(ve683[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 2227 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caggtgaTTATTGATTTTTGAGAATCTCCA ; Right flanking sequence: AAGGTCGTTTCTAGACAAAACTTTCAGCAA. sgRNA #1: AGAGAATGTTCACCGCGTTG; sgRNA #2: TTTGGAGCTAATAGATGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3184 lips-12(ve684[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTCCATACGCCACAATATCAACCTTACCCC ; Right flanking sequence: tggaagaattggaaaacttaaaaactgact. sgRNA #1: CTTAGTTGCAAGTTTTACGG; sgRNA #2: taaaaaaaactagtggagtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3185 lips-11(ve685[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 2595 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cgtgggtcgaacctccgacctatttctcca ; Right flanking sequence: ggtgcctcatcttatcagttgtgcttttca. sgRNA #1: actggtaacacggacgacta; sgRNA #2: tgagtgtctagacatggcaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3186 lips-17(ve686[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 2604 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggaaacaacaaaaccactcgaagttaccgc ; Right flanking sequence: TGGATGAtaaaaaaataattcttaaaaacg. sgRNA #1: aaagattgtaatacaagaac; sgRNA #2: AAATTAATTGATACACATGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3187 Y41D4A.6(ve687[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 C. elegans Homozygous sterile. Deletion of 4404 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+
RG3188 Y45F10D.7(ve688[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 6878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve688 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).
RG3189 lips-15(ve689[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1143 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: taggtacttccccgtataaaagagaacccc ; Right flanking sequence: ttcctttttttattatcagaaatccgtatt. sgRNA #1: gagtgaagattgtggagtta; sgRNA #2: aatatgcggatggatttatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3190 +/mT1 [umnIs52] II; Y54H5A.2(ve690[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 12039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve690 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: cacttgcagtttccgcttgatcacccaaat ; Right flanking sequence: cccgggtacgcgtccttctcaccgacaaac. sgRNA #1: ccgcttgatcacccaaatta; sgRNA #2: gtatacctcattcgcccacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3191 lem-4(ve691[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 C. elegans Homozygous sterile, Pvl. Deletion of 5370 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults (ve691 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: tctcttttcagctggaaactgtaaactcct ; Right flanking sequence: TGGGCGATTTTAGCATATCTTCCATGGAAT. sgRNA #1: ttatttaacttcctatctca; sgRNA #2: aactcacTTATACAAGTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3192 npr-33(ve692[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 3243 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTAATGGACCGAAAGCTGATGAGCTCCT ; Right flanking sequence: tggtcataaatttttgttgtatttttatat. sgRNA #1: CAGGAGAAACTGGTTAACTG; sgRNA #2: TCTTTCAACGCTTCTATGAa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3193 cct-8(ve693[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. C. elegans Homozygous larval lethal. Deletion of 5958 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve693 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CACGTGGTTTTGGTCCTCCAGTCGCCTGCT ; Right flanking sequence: CGGTTCCTTTGAAGTGCTGAGCTCCTTCCT. sgRNA #1: TCAGATTATTATGTCAAAGC; sgRNA #2: GCACTTCAAAGGAACCGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3194 +/mT1 [umnIs52] II; Y56A3A.19(ve694[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans DO NOT MAKE PUBLIC umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve694 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tcgcgtcgagacccctaaatctgtgcgcct ; Right flanking sequence: tcgggaaatgactcatcgagcctgaaaaat. sgRNA #1: ttctgatatacttttctcaa; sgRNA #2: aaaaaatttgacgggaaatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3195 frpr-12(ve695[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 2237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttagttccagtgagagaaaaatatcatgaa ; Right flanking sequence: TGGTTATACATCAATCAAAAGCATATGAga. sgRNA #1: ataacaacaataaggaATGA; sgRNA #2: ATCAAATCAACGTCTCATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3197 Y54G2A.75(ve697[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. C. elegans Homozygous larval lethal. Deletion of 635 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve697 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ccgaaatgccgcatcgcgtgttgtttagcc; Right flanking sequence: TGGAGCTCGTAAAGGACGTGGTCTTGTCAT. sgRNA #1: atcgcgtgttgtttagccag; sgRNA #2: ATCATCGAGACGGTCTATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3198 +/mT1 [umnIs52] II; ZK686.3(ve698[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1309 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve698 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tctttggagaaggggaaaacaccttctagt ; Right flanking sequence: GACGGCGAGCAGCATgaagaacagtaatac. sgRNA #1: gggaaaacaccttctagttt; sgRNA #2: CTGCTGAGCCGACTCGTAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3199 ZK792.5(ve699[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 3088 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve699 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ccctttttgtttgccaagattatcagatga ; Right flanking sequence: TGTGGCTTCTTCTCAGCATCAGCAGCAGCA. sgRNA #1: gccaagattatcagatgatc; sgRNA #2: AAATTGTTTCTCTCCTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3200 ZK809.3(ve700[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 863 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve700 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: cgaatttcaggctcaaATGGGTAACCAGTA ; Right flanking sequence: TGTTGGAGAGACAAAACGACCGTGGTAAtc. sgRNA #1: TGCGTTCTGGTTTCACATAC; sgRNA #2: GTTTTGTCTCTCCAACATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3201 +/nT1[umnIs49] IV; ZK856.11(ve701[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Mid-larval arrest, arrested larvae are somewhat Dpy. Deletion of 980 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested somewhat Dpy larvae (ve701 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aggcagcaggcgcataaacaggaaagtaaa ; Right flanking sequence: tcaggtttaaaaaaaattgagttttaagtt. sgRNA #1: cataaacaggaaagtaaagg; sgRNA #2: GTAGCAGCAGACATgatttc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3202 +/szT1[lon-2(e678) umnIs61] I; ZK899.2(ve702[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. C. elegans umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Larval lethal. Deletion of 2110 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 early larval lethal (ve702 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttaaaaaacgtagcacgcgtattttttac ; Right flanking sequence: tggaaaataattatatttcaactttgaaca. sgRNA #1: cttcaacttctctgacacag; sgRNA #2: tttcacaatttactagtaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3203 C17H11.1(ve703[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 7049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aacgcactggaaatttaatagttgtttgcg ; Right flanking sequence: ataaatgtattataaatatggacaatgttt. sgRNA #1: gtgaatccccacagagtact; sgRNA #2: gcacaataaattaagaagta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3204 lips-16(ve704[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1780 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGGTATTATATAGTTCCCTTTTGTTGAGTT ; Right flanking sequence: AATATTTTATTTCAATAGACTATCAATCCG. sgRNA #1: GTGAAGGTACTGAAATTGAC; sgRNA #2: GACATCAAACTATGTATGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3205 F19C7.2(ve705[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 2784 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattaataggactttccaaaaaattgttga ; Right flanking sequence: AGgtgagtttttgcgtcttgataaaaaatc. sgRNA #1: actgaaatcaaattggtctt; sgRNA #2: GCACAGGCTATTAGGACTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3206 ZK973.11(ve706[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous Unc. Deletion of 2352 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gacagtatatattagcactttgagcatttt ; Right flanking sequence: tggtgcagcacggctcggcgagcaccgctt. sgRNA #1: gagcaaaaatcttcgaataa; sgRNA #2: atcaatattcacggaacagt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3207 frpr-11(ve707[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 2244 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: catgttctctcatttatatgaaaatttcca ; Right flanking sequence: AGGAAGACAGAATACAAAAACTACCCGATC. sgRNA #1: acggaaagaatatagcttta; sgRNA #2: GAATTAACAGTATCAAGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3208 F19C7.4(ve708[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 2275 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtgttaaacggctataaaaaattcgtcca ; Right flanking sequence: aggttcatttaagaatgcctcttattcaaa. sgRNA #1: acaactatgggacaacgtag; sgRNA #2: CTATTAGGCAGCATTCAGgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3209 F28E10.5(ve709[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 2743 bp  with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tccatttttatacaaatttttcaataaacg ; Right flanking sequence: gacaactattttctcatgatttaagttttt. sgRNA #1: aaaaatgttcagaatctctc; sgRNA #2: catgagtagtgcacaacggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3210 F01D5.8(ve710[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 2965 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttcattccttgttcttctttgtcacaATG ; Right flanking sequence: CGGAAAATGAATAGgaattgttttctttct. sgRNA #1: CCACGTGGTGTACAGgttag; sgRNA #2: ACAATTGTCATCGAAGCGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3211 try-9(ve711[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1170 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gccaggatttaccactttgtcctctcatcg ; Right flanking sequence: TGGATTTCTTCTGCACGTGCTGTGGAATGT. sgRNA #1: cagaacttctgaggaataca; sgRNA #2: CGTGGATGTCTCGGCACACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3212 sups-1(ve712[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 2425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tcgctttcattcaatcctgaacgagaaagc ; Right flanking sequence: TGGAAGTCCATAAaaattggatttatgttg. sgRNA #3: gaaaccgaataatcacctat; sgRNA #4: ACAAAGAGAGGATTTCGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3213 F48E3.4(ve713[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 1703 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agaagtacagagcaaacacaaaatgtgcac ; Right flanking sequence: AGGAAACGATGACCGCTCGAAACATcttct. sgRNA #1: acgaaaatcaatacgttata; sgRNA #2: AAACACGAATGCAAGTAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3214 C02G6.1(ve714[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 3831 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agccacttcctcgtgtattttcgtaaactt ; Right flanking sequence: atttaatttgcacttgattggaaacttttt. sgRNA #1: cagtgtaatgttaaaaggtt; sgRNA #2: ccaagctaggatatctgtgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3215 F44E7.4(ve715[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 3659 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGGTGCTCAAGTGGATCGACACCAATTGGC ; Right flanking sequence: aaaaaaagttttaatggcattttctgagaa. sgRNA #1: TTCAAGTCTATAGCTGCGAT; sgRNA #2: ttgactttcttctaaatacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3216 npr-26(ve716[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 5117 bp  with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATACTTGTATCAGAATTTCCACGTGTCAGA ; Right flanking sequence: cggcgtcctggagagcccgacgccagaaat. sgRNA #1: GTTGAATCATTTTGCCATAG; sgRNA #2: ttctggtgtgtatgagtgtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3217 Y48B6A.1(ve717[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 3274 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve717 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ataataacaaaagaaaacgaaggtgtaaca ; Right flanking sequence: cccaacatttttccgatttcaatttctctt. sgRNA #1: aataaaaacaaagaacaacg; sgRNA #2: cctaaaatcgcgacgcacta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3218 Y70C5C.1(ve718[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 3804 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCCTGGGAACTTCCAGGACTTGCCCATTTT ; Right flanking sequence: tgggcaataattggcgagaagttttttgga. sgRNA #1: TGCGAGCATATGCTATTCCT; sgRNA #2: aaaaaccaatgtttacagag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3219 C25H3.7(ve719[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 2210 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaatcagtcgtctacaacacatcttcttg ; Right flanking sequence: CGGACTGCATtctgaaagagaaaaaatata. sgRNA #1: tatTCAATCGTCTCTCCACT; sgRNA #2: AGTTTTACCCAAGTTGAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3220 elpc-4(ve720[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 1058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tatttttaaagtaatttcagaATGTTGAAC ; Right flanking sequence: GCATTTGATGAGCCAGCTCCAGGTCATCAA. sgRNA #1: aatttcagaATGTTGAACGT; sgRNA #2: GCTGGCTCATCAAATGCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3221 veDf2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP] IV. C. elegans Homozygous viable. Deletion of 2996 bp, removes his-31, his-32, his-33 and his-34, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAGAGCATAGACGACGTCCATAGCAGTTA ; Right flanking sequence: CCTAATTGAGTTGTTCCAATAAAATTTTCA. sgRNA #1: CGAGCACGCCAAGAGAAAGA; sgRNA #2: TCTTTCAGAACAACATCTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3222 syp-5(ve722[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Him. Deletion of 5035 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: actaacATCGTCACTATCATCACTTTTCCT ; Right flanking sequence: TGGGACATttattgactgaaataattttaa. sgRNA #1: GAGCCAAATCAAAGGATGAC; sgRNA #2: CCTCCAAATTCAGCAGTAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3223 sec-11(ve723[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. C. elegans umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygotes are sick, Egl. Deletion of 2571 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sick, Egl adults (ve723 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: AGTTTTCCTTATGCAACAGGACGAAGAGAC ; Right flanking sequence: GAAGGAACTTCATctgaaatgggattatgc. sgRNA #1: GCAACAGGACGAAGAGACCG; sgRNA #2: TGAACATCGCAACATCGGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3224 +/mT1 [umnIs52] II; sftb-1(ve724[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 5479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve724 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gggattaaaatataaaaggtttcgttttct ; Right flanking sequence: atattcaaagaaatacactcaagaaactaa. sgRNA #1: atgaaaatgtgatgaaagga; sgRNA #2: tgttcattgtaaaaggatta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3225 Y56A3A.19(ve725[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/eT1 III; +/eT1 [umnIs46] V. C. elegans umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Homozygous larval arrest. Deletion of 682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve725 homozygotes), Unc-36 non-GFP mKate+ animals (eT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcgcgtcgagacccctaaatctgtgcgcct ; Right flanking sequence: tcgggaaatgactcatcgagcctgaaaaat. sgRNA #1: ttctgatatacttttctcaa; sgRNA #2: aaaaaatttgacgggaaatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3226 +/mT1 [umnIs52] II; snr-5(ve726[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Emb. Deletion of 430 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead embryos (ve726 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ttgcttaaattacttgtgtccttca ; Right flanking sequence: GGGAGGCGTGGACGGAGAAAACGAG. sgRNA #1: agggatatcgaaaatagtga; sgRNA #2: TGCAACAACGTTCTCTACGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3227 F31C3.3(ve727[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 8467 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtgtggtaccaaatgcacacaaacaacagc ; Right flanking sequence: CACAAAAGCGTGTCGGATGAGCTCGATCCC. sgRNA #1: gcagtaatatactcgggacg; sgRNA #2: TTTTGCGGTTCGATGATGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3228 txdc-17(ve728[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. C. elegans Homozygous viable. Deletion of 1195 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTCTGACAACCGGAGAGTCTTGGTGCCC ; Right flanking sequence: TCCAACACTCAAATTGACATGTATTCCGAC. sgRNA #1: TCGTACCAACAACACAATCC; sgRNA #2: TCAGTACGGAATCCGACAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3229 hum-4(ve729[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 12032 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCCCATTTTCAACAACTGACTTTAGTCGA ; Right flanking sequence: TTCCAGCTTCGGATTGATCTCTGTAATCAC. sgRNA #6: TAGTGCAGAACACCGAACGT; sgRNA #30: TAGCTCAAAATCTTCACGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3230 hum-6(ve730[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 10872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAGTATATTTTCTCAGGGTGACTTCATCTG ; Right flanking sequence: ttttGCAGAGTGTCAGGCGCGTGAATTAGG. sgRNA #11: aaaaGATAAACTCACGACAG; sgRNA #21: GATTGAGCCCGGAAAAACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3231 hum-8(ve731[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 11054 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCTTCCGATATTTCTGCTCCTCTTTTACCG ; Right flanking sequence: TGGAATTGTTTTCGGCTCAAATGTCCCAAT. sgRNA #51: CTACAGGAGACGCTTCTTGT; sgRNA #6: TTAGGATCCACAATGTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3232 gtf-2(ve732[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V. C. elegans Homozygous sterile deletion as an unbalanced het. Deletion of 3148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ adult sterile animals (ve732 homozygotes) and non-GFP wild-type homozygotes. Maintain by picking wild-type dim GFP+. Left flanking Sequence: GCAGGGACTCGGTGCAGATGCTCCAATCAA ; Right flanking sequence: tgggttatttagcccagttttctatttatt. sgRNA #3: AACTGGAAAACTGGCAATTG; sgRNA #4: AGGCACCACAGAGACTTGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3233 +/nT1[umnIs49] IV; rft-1(ve733[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval arrest. Deletion of 3806 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve733 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaaggaataaaatgaacaaggTCACCGACA ; Right flanking sequence: TCGGGAAGTTTCGCTGTCAAAAGTGACAAT. sgRNA #3: ACCGACATGATGGTGCAGAG; sgRNA #2: CTGGGTAAGTTCCATCCTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3234 snrp-200(ve734[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 9661 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve734 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttgaaaagaataataataataatacaaata ; Right flanking sequence: aggttaaaaaaatcaaaacaagaaataaaa. sgRNA #3: gaccagggagtgggtgacgg; sgRNA #4: GAATCCAGCAGTATGAGTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3235 Y39B6A.3(ve735[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V. C. elegans Homozygous early larval arrest as an unbalanced heterozygote. Deletion of 852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ arrested larvae (ve735 homozygotes) and non-GFP wild-type homozygotes. Maintain by picking wild-type dim GFP+. Left flanking Sequence: tttattagcattttttctagaatgtacacg ; Right flanking sequence: tttttttctgtaaattttttacgaaaatat. sgRNA #3: CGTCACCGATAAGCTATCGT; sgRNA #4: ggtaaactacacgcgtggcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3236 Y40B1A.1(ve736[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 2839 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gagcctcgaaaactccccaaaaactatacc ; Right flanking sequence: tttcgtgtatttttccgtttgtgtgcaaaa. sgRNA #3: cgtcttgtagatcagctcgg; sgRNA #4: agagatcatcactggaatgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3237 ZK265.7(ve737[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 6749 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cgtttgtctccttttctccaagccccgccc ; Right flanking sequence: ACTGGTAGCACTTCCCTTCTCGTTTCTGTA. sgRNA #3: tgagctgtctcacaagtggg; sgRNA #4: AGTGATTTTGAAAACTCTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3238 msp-59(ve738[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 722 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: attggaaggtggcctccacctccaccaaat ; Right flanking sequence: tccccctatcgataaacttcaacactacaa. sgRNA #1: attcaaaagcgtatcaaatt; sgRNA #2: ggcatttcatgtgaattaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3239 ZK858.7(ve739[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous lethal. Deletion of 2453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 lethals(lethal mid-larval to adult) (ve739 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation in hT2 is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: catattattaaattttaagtgtaaaagatt ; Right flanking sequence: aggcaacagagaacgaacgataaagtagtc. sgRNA #1: gaggaaatatgcaatttact; sgRNA #2: atcgacgagacggctacgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3240 B0035.15(ve740[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 1324 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve740 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaactttaaaacttgtaacttcataagcaa ; Right flanking sequence: cggtacttctttaaaggtacagcacccgaa. sgRNA #1: aacaacttaaaatcgacccg; sgRNA #2: gatcgcaaaaattcggggta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3241 set-14(ve741[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 2026 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCATTGAATCAGGTGTATAAATCTTTTCCA ; Right flanking sequence: AGGCTTCTATTTCTCCATCTTCGTTTCTGC. sgRNA #1: CCAAGAAATTGAAGAACCAC; sgRNA #2: AGCAACACCCGGAATATAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3242 +/nT1[umnIs49] IV; F45F2.9(ve742[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve742 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CGCTTTGTTGATTCGTTTCATTCGATTCTC ; Right flanking sequence: ATTGTCAAGAACATCTAGCAATTCGAAGAT. sgRNA #1: TCTCAATTCTCGATCCCACG; sgRNA #2: TTGAAACATCTCAAGCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3243 F54B11.5(ve743[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 1530 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagaTCAAGTTTCACGGGCGATTTCCTTCA ; Right flanking sequence: cggaattagtcatgcaaaacacatgacatc. sgRNA #1: AATACTCGTTCACTTCAGCC; sgRNA #2: aagaaaaacgtatgtttatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3244 C36E6.2(ve744[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttctcaggaatgcacacacaaagggaccct ; Right flanking sequence: TGGAATGAttcgagaccttgtaaattctat. sgRNA #1: actgccctccttgtcatatg; sgRNA #2: TCCACCTCAAGAGGACATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3245 +/mT1 [umnIs52] II; Y48A6C.4(ve745[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 6712 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve745 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tgggaataattttctctcgaatcaatatct ; Right flanking sequence: tttaattttttaaagttaaaaattttctag. sgRNA #1: atgaaacttgcacttcaccg; sgRNA #2: aagcggagtcgggaagaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3246 Y54G9A.7(ve746[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve746 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ctatcctattgatttcttCTACTTTTTCCG ; Right flanking sequence: cggtgcccaatctgcatatgcccagccgtg. sgRNA #1: AGAAATACGCGAAATTATAT; sgRNA #2: aatgttttgcgcgtcagatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3247 mdt-22(ve747[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 556 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve747 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttattttttgttttacaactatttaactta ; Right flanking sequence: CGGAAGTGAGCAATATTCTATTCGATCTGG. sgRNA #1: tttaaaATGTCTGGAGTAGC; sgRNA #2: TCAGCACAACTGTCTCGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3248 +/nT1[umnIs49] IV; Y57E12AL.6(ve748[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous early larval lethal. Deletion of 661 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve748 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TCATCTTGGAATCAAAGTTGAGATAATCAG ; Right flanking sequence: aggcggtttgctggcgcgtttctcgttcct. sgRNA #1: CAAAGTTGAGATAATCAGAT; sgRNA #2: tcatcatttattattgcgca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3249 nuo-3(ve749[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous mid larval arrest. Deletion of 348 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve749 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ctgaaaaataaaaaatCTATTCCTTTCCGT ; Right flanking sequence: CGGAATTGTTGGATTTGATTGGAGCGACGG. sgRNA #1: aaatCTATTCCTTTCCGTTG; sgRNA #2: CAAATCCAACAATTCCGCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3250 Y57G11C.31(ve750[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Emb. Deletion of 4555 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead eggs (ve750 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ccagtaATGACCGAATCCACAAAATCCGGT ; Right flanking sequence: aattcatgtggaatgtttcagaatgttcac. sgRNA #1: GAATCCACAAAATCCGGTGG; sgRNA #2: aacagagaaatcatgaagtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3251 +/nT1[umnIs49] IV; zhit-1(ve751[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous animals are sick. Deletion of 586 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sickly larvae (ve751 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: cagattaaaaaaaaaacttacTTGGCACCA ; Right flanking sequence: AGGTTTTCGTGAAGGAGCAAACATttttga. sgRNA #1: AAGTACTGTTGTACGCGATG; sgRNA #2: AGTTGATTGGCTGTTGCAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3252 F10D2.10(ve752[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 1587 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACCCGTCCCTTCCGCATCAAAAATCTTTTT ; Right flanking sequence: gccgaatgaacagaccacttttttagaatg. sgRNA #1: CACAACCTCTGCCACCAAAT; sgRNA #2: cattctatcgtttactctcA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3253 T13C5.10(ve753[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 1497 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtcacgtaaaattttcaaaatggttgacca ; Right flanking sequence: AGGATAAtaaaaaatcgtattttaaatgct. sgRNA #1: tatgtacacctgccccaaaa; sgRNA #2: ACGTGCCAATCAGTAGTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3254 puf-12(ve754[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous late larval arrest. Deletion of 2530 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve754 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: attactccttttaatatgcgtgtctttcag ; Right flanking sequence: AGGCACAGCTCGACGGAAATGTCAAGAAGT. sgRNA #3: GAAGAAGGTTAAAAATGTGT; sgRNA #4: ATCAGCAGAAAACACTTGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3255 F35H12.5(ve755[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 1604 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tcagATGTTTTCTTCACGTCATATTTTATC ; Right flanking sequence: GATTCTATTTTTGATGCTGACAAAGAAGTC. sgRNA #1: AAACGTTCGTCCAATAATAA; sgRNA #2: CACAACTTCTACAATAAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3256 cap-1(ve756[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve756 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tggagaggattaggaagatgatgaagacca ; Right flanking sequence: tacttgagatatttagtttgaaatgttttt. sgRNA #1: tttgcttcaagttcgtctgc; sgRNA #2: atctctatccactttccgtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3257 pfd-2(ve757[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. C. elegans umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Maternal effect embryonic lethal. Deletion of 1394 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Adult worms which lay dead eggs (ve757 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaaaatccacaacttccagATGTCGGCCG ; Right flanking sequence: TGGACAATTGCCAAAAGCTTAAatttcccc. sgRNA #1: AGTGGCGGCGGCGGTTTGAG; sgRNA #2: CTGAGAAAAGCTGAAGCTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3258 tag-124(ve758[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gaaatcgatcccttttaatcactttttcct ; Right flanking sequence: TGGAGAGCAAGAAAGAGAAAATGGCAGAAA. sgRNA #1: taattaaacgctagaagaat; sgRNA #2: TAGGAAAATGTGTGAAAGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3259 +/mT1 [umnIs52] II; cisd-3.1(ve759[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous late larval arrest. Deletion of 375 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve759 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ctcagttatgtgtgaatgttatcagtttta ; Right flanking sequence: TGGATATAGTGGATCGCAACCACTCTGCGA. sgRNA #1: cagaATGCGGATAACTCAAT; sgRNA #2: GTTTACGCATGGTGCAGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3260 tmed-3(ve760[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 725 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgaaaatcgtagaaactgtaataatttga ; Right flanking sequence: tcctccctttgatacatagcataagaatat. sgRNA #1: taatttcagGTTGTTACTGG; sgRNA #2: aaaggggcaaaacaactgac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3261 +/nT1[umnIs49] IV; F53F4.11(ve761[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous early larval lethal. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve761 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CATGCACAGTTGGGAACAGTACAGACTGAT ; Right flanking sequence: AGGAGCAACTGACTTCACAACCTGCAGCTC. sgRNA #1: CGGTATCTTCCTTGAGAACA; sgRNA #2: TTCTTCGCAACTTCAACTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3262 F56B3.4(ve762[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. C. elegans Homozygous sterile. Deletion of 3719 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults (ve762 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: aggacgaaaatcgaattctccgcgattttt ; Right flanking sequence: tatgagctgaagaatattttaaaatagaac. sgRNA #1: cgctcctgggcaccgaattt; sgRNA #2: ctaagtccgatccagtgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3263 F15D3.6(ve763[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 1689 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve763 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: gaaatcagtgatcaggcaacagacaacagc ; Right flanking sequence: cggaaatcgcgatggcgaagcacacaaaaa. sgRNA #1: tgatgtgaaccagagaaagc; sgRNA #2: ggtaaaagtctgcggaatga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3264 Y57G11C.33(ve764[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 1238 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cgcagtggatcatattcagcctctgctccc ; Right flanking sequence: aggtgcgatatatgttatgttttttttttt. sgRNA #1: ttgtcgatcgtagtgcagag; sgRNA #2: cgatcccttgaatcaaatcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3265 C30G12.2(ve765[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1073 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cttcattattctaagttctcaacaATGCCA ; Right flanking sequence: ATGCATTTGCGCGTCAATCATTCATGGAAC. sgRNA #1: TTGCCTTTCAGCTCATAGTT; sgRNA #2: TCAGAGCAGATTTACTCATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3266 trm-1(ve766[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 2466 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atcgatttttcctcaatctgaaaataagta ; Right flanking sequence: aggaagaataaaaaacgtttttgtccttga. sgRNA #1: gaagtgcgctaaataagaag; sgRNA #2: cgggaaaaaatactgcgcga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3267 +/mT1 [umnIs52] II; C16C10.8(ve767[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous late larval lethal or sterile. Deletion of 1175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 larvae (ve767 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atggtgtttcatgagaaatgtggctctccc ; Right flanking sequence: TTGACAATCAATACAGCTGAAAGTAGTATT. sgRNA #1: tgaactcacacaatttcacc; sgRNA #2: CTTGTCTACACgtaagcttc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3268 +/mT1 [umnIs52] II; F10E9.11(ve768[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 665 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve768 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tTCATTTCTTCTCCTTTTTCTCCTTATCCA ; Right flanking sequence: aaaatataatttatgccagtaatgagtatc. sgRNA #1: CGAGAGGATACAGAAAAGAG; sgRNA #2: cgaaattcatgtcacgagcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3269 F10G8.9(ve769[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous sterile. Deletion of 2540 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve769 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: atgaaattaaaaataaataaaaattttgag ; Right flanking sequence: ATTTGTAATTCATTTGGATTCGGTGCCACA. sgRNA #1: ATGCACCGTGTTGTTATAAC; sgRNA #2: TGAGATTCGCGATTTATTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3270 F52E1.2(ve770[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. C. elegans Homozygous viable. Deletion of 1067 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattttttgataattttttACAAAATGCCA ; Right flanking sequence: AGGGAGCAAGTGCATAACAAGTCGAAATAA. sgRNA #1: ATTAAAAACGCGAGTGAAGT; sgRNA #2: TGCGAGTTACATTTGTGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3271 T01B7.5(ve771[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous early larval arrest. Deletion of 3511 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve771 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaattgctaatttttggatttcagatacta ; Right flanking sequence: gttgaatgtgtttttgtgtgcccggtcact. sgRNA #1: gaactATGTCATCAAGGAAG; sgRNA #2: cgactaaaagggcaaacgag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3272 C25F6.7(ve772[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 2402 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGTGATTTTTCTATACCCAGTCAGAATT ; Right flanking sequence: AGGTACAACTGGAAGAGATCAGCTTCTAAA. sgRNA #1: TCAGATGACGATCTTCACTA; sgRNA #2: CGCATCAATGGCTGGTGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3273 F13H10.3(ve773[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 3011 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATACATAAACTAATCCAGAAATTGATCCCA ; Right flanking sequence: AGGACATTTTTTCACTGCAAATCGCCGAAT. sgRNA #1: CAACTTAACTTCCAGATATG; sgRNA #2: TACACCAATAGCTCCATACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3274 C01A2.4(ve774[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 1406 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAATCAAAAGACTAAAAGTATTGGAATGAG ; Right flanking sequence: CCGGCTGATTTCGATGATCTCGAAGCTCAA. sgRNA #1: TGCAAGAATTAGTGGAGTAC; sgRNA #2: AGCAGTGCTGGAAACCTTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3275 C01A2.4(ve775[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 1714 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAATCGGAATTTTCCAAGGATGAACATT ; Right flanking sequence: AGGTTTCCAGCACTGCTCCGGCTGATTTCG. sgRNA #1: TTCTCGAAGCCCGATCCAAA; sgRNA #2: TGTCCCTGCTCTTCCCACAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3276 dna-2(ve776[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Maternal effect sterile. Deletion of 3982 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that produce sterile progeny (ve776 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatgtctgctgcccgcccgcccgttgcct ; Right flanking sequence: ccttttttactcatttattagatttctcac. sgRNA #1: gattctggctgcgaaatacg; sgRNA #2: cgggaattTTACAGTTGAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3277 +/mT1 [umnIs52] II; C14B1.8(ve777[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Sterile. Deletion of 858 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve777 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TTTTCTTGAGCTTCATCGTCATCGAATCCG ; Right flanking sequence: TGGATTATCCATttttgaactgaaaattca. sgRNA #1: AAAATTATCAGCGAGGGAGA; sgRNA #2: AATAAGTCGATTTCTTTAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3278 nprl-3(ve778[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Possible maternal effect: descendants of homozygous animals may be sensitive to starvation (lethal). Deletion of 2127 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate adults (ve780 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: AAATAATTTTGAATTTTCAGTGCTGTGATG ; Right flanking sequence: AGTAGCCAAGGATCTTTTATTCCGGTTTTT. sgRNA #1: TGTTTTCTCACTGGACAAAG; sgRNA #2: CGGCAACAAAATCAGGACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3279 asah-1(ve779[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 2292 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGAGAATTGTCGGTTTTGTTGCTGGTGGC ; Right flanking sequence: GAGACTTCTCGCTTCGAGACCATCCTTCAA. sgRNA #1: TGTGTGCGCCGCAAAGCATG; sgRNA #2: GACGGACATGAGGACGGTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3280 slc-17.2(ve780[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. C. elegans Homozygous viable. Deletion of 2131 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCAATCTTTTCTCCTTCTCTAAGTGGAGC ; Right flanking sequence: CGGTTTGGTAGTAGCCCCTTCCATAATTAT. sgRNA #1: CATCTCATGGCCTTCTTCGG; sgRNA #2: TACTTTACGATCAACTCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3281 pdi-3(ve781[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. C. elegans Homozygous viable. Deletion of 4472 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagtcgaagctgcaaacaataaataaataa ; Right flanking sequence: gggaacaccgacaaaaagttaaaaactaag. sgRNA #1: attacaaaagggaaacaacg; sgRNA #2: ttagagggcgagagattatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3282 +/nT1[umnIs49] IV; Y61A9LA.10(ve782[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 8730 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve782 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ctTCAGGAGCTGCTCGCCGATGAGCCAAGA ; Right flanking sequence: cacggcgtgcgcgtcagtgtcacgaaacgc. sgRNA #1: GCAAAACTTCGAAAGGCTCT; sgRNA #2: aaattggttgctgacgcgca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3283 +/mT1 [umnIs52] II; pod-1(ve783[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous maternal effect lethal. Deletion of 9240 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that lay dead eggs (ve783 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gagacaaataaaaagcgagagagggagagg ; Right flanking sequence: tggcccgaaatttatatcaattttgcggac. sgRNA #1: tggtgatggattggtgatgg; sgRNA #2: agcgcacacacaaacacaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3284 eif-3.C(ve784[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans Homozygous larval lethal. Deletion of 2440 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve785 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: CTTCTGCTGAGCATACGACGACGCATTTCG ; Right flanking sequence: ttaaataataatttattatttaatcacaat. sgRNA #1: AATTCGCAACTAGCCATGTG; sgRNA #2: atctccgcgcaaatgcccac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3285 cyp-42A1(ve785[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. C. elegans Homozygous Emb. Deletion of 3977 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, dead eggs (ve785 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: TTCGCATTCCGGAAAGCAAAATTCATTTAC ; Right flanking sequence: TGGTTCCTCCACTTAATGGGAGCAAATCCA. sgRNA #1: AACAAGCTTACGGTCTTCCA; sgRNA #2: CAACATCAGCCGCAATGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3286 H40L08.3(ve786[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. C. elegans Homozygous viable. Deletion of 6197 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGTTTTGAGATTTAGCAAGTAAATTGAGA ; Right flanking sequence: AGGATAATAATCGTTTTACCAGAGGCAAAG. sgRNA #1: ACGGAGTGTTCTAGGCGTCG; sgRNA #2: GTTTCACATCTCCGTTTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3287 C23G10.7(ve787[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. C. elegans Homozygous viable. Deletion of 3575 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tccttgtatcgtccatttgaatgtcatcca ; Right flanking sequence: cagtgaaaaattaagcattagagcggtcaa. sgRNA #1: agtgaattttgtggcggctt; sgRNA #2: atcgtctcaaagctatgcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3288 F41C3.8(ve788[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 2556 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caatttcactggtctatttctatttcgcca ; Right flanking sequence: GGGATCCGTTAAAGAATCTTCATCACAAGA. sgRNA #1: ttgtcacacgctcatacgtg; sgRNA #2: GTTATTTGCCTACTCATAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3289 +/mT1 [umnIs52] II; C56G2.3(ve789[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Sterile. Deletion of 1669 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve789 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: acttctggactttaattcccttacctatta ; Right flanking sequence: aggtgaagctgagcgtggcaactcacttca. sgRNA #1: cccagtgacgatattgagat; sgRNA #2: tttctctagctctttcagac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3291 cox-18(ve791[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. C. elegans Homozygous Ste, Pvl. Deletion of 2404 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ Ste, Pvl adults (ve791 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+.  Left flanking Sequence: gaaattcgaaatctacgcaaaatttcagcg ; Right flanking sequence: agggcaaaaaaaaaattgcttaagcctgag. sgRNA #1: accaaatcacgaaaactaga; sgRNA #2: tgaccccaaccagtttctga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3292 F49C12.11(ve792[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 531 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAGGCAAAGCCACTGAAGGCCGCAAAAAA ; Right flanking sequence: cggtcaaatattatgccatctcatccgcaa. sgRNA #1: AACGGAGAAGGATCTTTCTG; sgRNA #2: CAGGAAAGAAGTAAttgcct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3293 ugt-20(ve793[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 2672 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAATCAGAATAAAAATTGCGATAATGTCCA ; Right flanking sequence: tggtgtcaagatttttttgtacagagagac. sgRNA #1: ATTCGTTGAGTACTTCTTTT; sgRNA #2: atcctaacagttctgcccag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3295 Y53G8AL.1(ve795[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. C. elegans Homozygous viable. Deletion of 6742 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACCCGGAGAACGACTATTGGAAGTGCTCCG ; Right flanking sequence: cggaatcggaaaattcagaaaatttcagtt. sgRNA #1: TTGAGCACCACATCACAGGT; sgRNA #2: aaatcatgttacagctgtag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3296 T20D3.6(ve796[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. C. elegans Homozygous viable. Deletion of 526 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagaacattttatgaatcaaaagTTAAGCA ; Right flanking sequence: CGGAAGTCATGTGGCTCGGCGTTCATtttt. sgRNA #1: GAATTATTCTGAGGAACCGC; sgRNA #2: TTATATGCGCTTTGTGATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3297 +/nT1[umnIs49] IV; F25H9.6(ve797[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Sterile. Deletion of 1068 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve797 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aatagaagaaaaatatgatattgtCTACCC ; Right flanking sequence: AATTCGTCGGACATgttaaccgaacaagtt. sgRNA #1: AGGCAGTTCGCATCCAATGC; sgRNA #2: ATCAGTGAAAAGGCACAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3298 M05D6.5(ve798[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1412 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gagagaaagtatacaatttatTCATTTCTG ; Right flanking sequence: ACGGAACATGCCCATtttgtgtgaagagag. sgRNA #1: GTGCTCCTCATCTTCATACG; sgRNA #2: ACAGCTTTCATGAACGTCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3299 wbp-2(ve799[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous sterile. Deletion of 1296 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve799 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: taccacttgtttaatttatatttagATGTC ; Right flanking sequence: TAActtgtaaatttaacaacaaaaaatgac. sgRNA #1: CATCAACACGGCGAACACGC; sgRNA #2: ATTTCTTCGCCTCAATCCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3300 npl-4.2(ve800[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. C. elegans Homozygous viable. Deletion of 1752 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTAAAAATCTATTTTATTTCAGATATGGTA ; Right flanking sequence: ACATTCCAAAACGAAGCAGGAAGACAGGAT. sgRNA #1: CGTTGACACGCTCAGTTTGA; sgRNA #2: ACAGTGTCCACAGCTCCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5003 dxbp-1(gk5666[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5666 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4596 and CGC92. gk5666 is a 2234 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGTGGGCGGCAAAATATTTTTTCCGCCAAACCGGCAAATTGCCGGAATTGAAAATTTCCG. Right flanking sequence: TTCGGAAGTTAAGTGGCATTTGAAGCCGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5004 eif-3.G(gk3804[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk3804 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC3837 and CGC48. gk3804 is a 717 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTGTTATCCGATGGCCAAAAAATTCGCCT. Right flanking sequence: AATGATATCCGAATGTACCATATGGTTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5005 F10B5.2(gk5455[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5455 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4374 and CGC48. gk5455 is a 2246 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACTGCGATCTTGCTTCAAGCTATGCGAATG. Right flanking sequence: TCCGAGACTCTGCACACGCCGGTGATGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5006 stip-1(gk5457[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5457 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4376 and CGC48. gk5457 is a 3229 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTGGTGCCATTGGTGGTGGTGGAGCCATTG; Right flanking sequence: TTTGGCTGCATGTTGTTTAGTGGCATGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5007 glb-4(gk5468[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5468 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4390 and CGC48. gk5468 is a 5263 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGGAACATACTTCTTCGTCGATATGGAGTA; Right flanking sequence: ATGTACTACATGTTTTCGATGTGTAGATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5008 tars-1(gk5534[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5534 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4460 and CGC48. gk5534 is a 2908 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTCAATGCATTAGAAGACGTGGGCGCGT. Right flanking sequence: TACGGGAGAGGCAGAGTGCACAGAGGAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5009 pdha-1(gk5568[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5568 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4497 and CGC48. gk5568 is a 1334 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TATATTTACTGCTTTCAGTAGCTTGGTACA. Right flanking sequence: ATTGGAAGAGCTTAAACGACACGAATTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5010 sap-49(gk5542[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5542 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4469 and CGC48. gk5542 is a 1365 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGTGACTAATTAGTTTTGGTGTGTCCTCCG. Right flanking sequence: GACGTTCCCGAATCAACATCTCTCATGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5011 mecr-1(gk5557[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5557 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4485 and CGC48. gk5557 is a 1365 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCATGATCAATCTTCACATCACATTAAATT. Right flanking sequence: CGGAATTCGCACAGTTTACACAGATTTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5012 pno-1(gk5573[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5573 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4502 and CGC48. gk5573 is a 3472 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTGAATGGGTGAAGGGGCACTATATTGG. Right flanking sequence: TTTGGAGCAGTGTCCAAATTTTGCTCGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5013 eif-2Bepsilon(gk5600[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5600 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4529 and CGC48. gk5600 is a 2890 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAATTTTGCAGATGCAATGACGCCCTACC. Right flanking sequence: CTTGTTATGACTGAAAGTTTTCAACCACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5014 eif-3.F(gk5606[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5606 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4535 and CGC48. gk5606 is a 1569 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGCTTCGAATTTAACTGTCAATGTCCACCC. Right flanking sequence: CCCTCCCGAATTTGAAATTAGCGTTTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5015 tpi-1(gk5612[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5612 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4541 and CGC48. gk5612 is a 3448 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCCTGGGCTTGTTCTCCAGAAGCAGTCTT. Right flanking sequence: TTTGGCGAAAACTCGATTTTTTACCAAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5016 F59B10.3(gk5677[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5677 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4607 and CGC48. gk5677 is a 2307 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAGAAGAGGCGGAGGATTGCGGCGATATGT. Right flanking sequence: CGATTTTCTGTAAATATTTGCTCAAACCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5017 tnc-2(gk5693[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5693 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4623 and CGC48. gk5693 is a 2787 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTTTAGTCGGTTTTTCTGATATCCAGGT. Right flanking sequence: CATTCACTGACTTCCAATAATTCTTTTTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5018 iars-2(gk5471[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])//hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5471 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4393 and CGC92. gk5471 is a 3877 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAATATTCGAACTTCTCGATGGTCCACCA; Right flanking sequence: ATAGAAAACAGGATTTGATGTTGAAAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5019 F28D9.4(gk5478[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5478 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4400 and CGC92. gk5478 is a 2626 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTTTACCTATTGCTTTTGCTCTGTAGTA; Right flanking sequence: GACGGTGTTGCTGCTGGGCTGCTGCTCAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5020 hrpr-1(gk5481[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5481 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4403 and CGC92. [NOTE: RG5020 and the parental strain VC4403 exhibit weak red fluorescence. The cause of this fluorescence is unknown, but gk5481 is a clean deletion/insertion confirmed by PCR.] gk5481 is a 2871 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGCTTTCAGGCAATCGTCACGCTCGTTGA; Right flanking sequence: GGCGGGAGATCTGCAAAAATCGATAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5021 spcs-1(gk5510[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])//hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5510 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4435 and CGC92. gk5510 is a 735 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAAAACCGCTCCAGCGCGGTACATTTCTGT; Right flanking sequence: GTAAAATAGAGATTTTCCATGGAGCGCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5022 nola-3(gk5610[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5610 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4539 and CGC92. gk5610 is a 433 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGCTACTCAGCACGTGCCTATTATCCTCAC; Right flanking sequence: GCTGGTTTGGGAGTGGCGCCGCATGTTGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5023 C45G3.3(gk5549[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5549 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4477 and CGC92. gk5549 is a 1227 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTTTTGAACGCTCGCGCCACAATGTCATA; Right flanking sequence: ATTTTCCCTTGTTCTCTTGCTCACAGTAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5024 cox-7C(gk5632[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5632 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4561 and CGC92. gk5632 is a 1065 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACATCAAAGTCAGAGTTTTATGGCTCACCG; Right flanking sequence: GGGGCTTGTAAGATGAGAAGCACCCGTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5025 F26E4.4(gk5646[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5646 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4575 and CGC92. gk5646 is a 1524 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAAAACTGGATAACAATAAATTGGCAA; Right flanking sequence: TGGAAAACGCACGCGACGCGTGACCGCAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5026 prp-4(gk5373[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5373 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4290 and CGC92. gk5373 is a 1874 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGGCCAGCAGCATCAGCACGCACCCGGG; Right flanking sequence: TGTCTTGGCGGTGCTGGAACAGCAAAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5027 pbs-7(gk5705[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5705 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4636 and CGC92. gk5705 is a 737 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACATGGAGATACTGAAACGCATCCTGCA; Right flanking sequence: TCAGCTGAACGGAAATTCAAACCTTGTAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5028 ZC434.4(gk5836[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5836 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4768 and CGC92. gk5836 is a 1235 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCCATTCTTGATATGCAATGTTTTTTAAA; Right flanking sequence: TGGGCTAAGAGTTCCGATGCACCCTCGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5029 F30A10.9(gk5733[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5733 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4664 and CGC92. gk5733 is a 957 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGAACCAAACAATCATCAGCATATGTTCCT; Right flanking sequence: AATATCAGAAAAAATTTTTGCGAAAAAGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5030 gfi-2(gk5771[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5771 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4702 and CGC92. gk5771 is a 2938 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGAAACTTCATCAATATCAATGAATCTGC; Right flanking sequence: TCACTCCTGGGTACTGAGTACCTTGACGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5031 +/mT1 [umnIs52] II; tftc-5(gk5467[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5467 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4389 and CGC66. gk5467 is a 2935 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTCGTATTATGGCGGAACGGAAACCTCAG; Right flanking sequence: GCAATGAATGAGCTAGTGGCTGTTGTAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5032 +/mT1 [umnIs52] II; C14B9.10(gk5476[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5476 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4398 and CGC66. gk5476 is a 1853 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACCAAACCGTCAGACATGCTGCGTCTCCT; Right flanking sequence: AACTGGCAAGAAATGGTTCCGCATTGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5033 +/mT1 [umnIs52] II; F45G2.10(gk5482[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5482 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4404 and CGC66. gk5482 is a 2468 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTAAACACGTTTTTATTCGAAACCTGAT. Right flanking sequence: GCTGGAAATGGAAAATGACGAAAAAATATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5034 +/mT1 [umnIs52] II; mrps-18C(gk5520[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5520 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4445 and CGC66. gk5520 is a 1322 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAGGTCGCAGAAGAACATTGACCCCAGCTC; Right flanking sequence: GAAGAGATAAAACGAAAGCTAAGATTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5035 +/mT1 [umnIs52] II; C16C10.2(gk5524[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5524 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4449 and CGC66. gk5524 is a 957 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAACTACTTCTTTCGTTCATAGGTCCATTT. Right flanking sequence: CGAGGACATGGCTGGCTGAAAATAATTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG559 hbl-1(ve18) X. C. elegans Pvul. Egl. Precocious alae. Heterochronic defects are suppressed in post-dauer stage animals. Reference: Abrahante JE, et al. Dev Cell. 2003 May;4(5):625-37.
RG733 wIs78 IV. C. elegans wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)] IV. GFP expression in seam cells and adherens junctions. Check periodically for GFP in seam cells to retain robust expression. ajm-1 previously called jam-1. Derived by outcrossing JR1000. It is not know whether the ced-1(e1735) or unc-119(ed4) mutations are still present, as the array rescues both phenotypes. wIs78 males do not mate very well; heterozygotes mate fine.
RG93 lin-29(ve5) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, Egls which have a protruding vulva, and DpyUncs. Maintain by picking WT. lin-29 suppresses rol-1 phenotype (rol-1 is an adult specific Roller and lin-29 animals never molt to adult cuticle).
TEST Test C. elegans Aliquid alias mollitia molestiae et obcaecati ipsa earum laborum Minim ex
VT132 sqt-1(sc13) lin-29(n333)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are slightly shorter than WT and segregate more animals which are slightly shorter than WT, Rollers which are Egl and have a protruding vulva, and DpyUncs.
VT516 lin-29(n546)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are slightly shorter than WT and segregate DpyUnc and Egl.
VT573 lin-4(e912) II; lin-14(n179) X. C. elegans lin-14(n179) is temperature-sensitive. lin-4; lin-14 double mutant may be maintained at 20C.
VT592 lin-28(n719) lin-10(n1390) I. C. elegans Vul.
VT664 lin-28(n719) I; nIs2 IV. C. elegans nIs2 [lin-11::lacZ + lin-11(+)] IV. Egl. Integrated on IV near dpy-20.
VT723 lin-28(n719) I; lin-3(e1417) IV. C. elegans Egl. Vulvaless due to lin-3. Precocious VPC divisions and adult alae due to lin-28.
VT757 lin-28(n719) I; lin-12(n137n460) III. C. elegans Only gives a decent brood size at 20C. At 15C: Muv/Blip. At 20C: some Muv/Blip, some Blip but not Muv. At 25C: Not Muv, but do have Blip (due to lin-12). Egl- at all temps.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
ve18 Allele deletion splice_site
ve5 Allele