Strain Information

Name RG3151   View On Wormbase Documentation for RG3151 ve651 T20B5.2
Species C. elegans
Genotype+/szT1 [lon-2(e678) umnIs61] I; T20B5.2(ve651[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X.
DescriptionumnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Homozygotes are unhealthy. Deletion of 5228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sickly adults (ve651 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaggggagggaaaacagttgaggacttttg ; Right flanking sequence: GAATGCGCATACTTGATGGAAAACCCGCTC. sgRNA #1: aacagttgaggacttttggt; sgRNA #2: ATCAAGTATGCGCATTCGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
MutagenCrispr/Cas9
Outcrossedx0
Made byRG KO Group
Laboratory RG
Reference n/a
Sign in or register an account if you want to order this strain.