Strain Information
| Name | RG3132 View On Wormbase Documentation for RG3132 ve632 erh-1 |
|---|---|
| Species | C. elegans |
| Genotype | erh-1(ve632[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
| Description | homozygous viable. Deletion of 566 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggaaagagatagaagtgagaaacccatatg ; Right flanking sequence: tttggtgttcgggcaatttttatttttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | RG KO Group |
| Laboratory | RG |
| Reference | n/a |
Sign in
or
register an account if you want to order this strain.