Laboratory Information
| Name | NK View on WormBase |
|---|---|
| Allele designation | qy |
| Head | David Royal Sherwood |
| Institution | Duke University, Durham, NC |
| Address | 124 Science Dr. FFSC4244 PO BOX 90338 Durham 27708-0338 United States |
| Website | http://www.biology.duke.edu/sherwoodlab/Welcome.html |
| Gene classes |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| DQM1152 | bmdSi243 I; ljf3(unc-34::mNG-C1::3xFlag::AID*) V; qy41(lam-2::mKate2) X. | C. elegans | bmdSi243 (LoxN + cdh-3p::TIR1::F2A::DHB::2xmTurquoise2) I. bmdSi243 is a MosSCI insertion. mNG tag inserted into the C-temrinus of the endogenous unc-34 locus. mKate2 tag inserted into the C-temrinus of the endogenous lam-2 locus. |
| FDU1056 | mig-17(shc19[mig-17::mNG +LoxP]) V. | C. elegans | C-terminus of endogenous mig-17 locus tagged with mNeonGreen using CRISPR/Cas9. Reference: Fan J, et al. Elife. 2020 Apr 7;9:e55890. PMID: 32255430 |
| LP511 | lin-3(cp226[lin-3::mNG::3xFLAG]) IV. | C. elegans | mNG and 3xFlag tags inserted into the C-terminus of the endogenous lin-3 locus. |
| NK1339 | rrf-3(pk1426) II; qyIs127 V; qyIs166 X. | C. elegans | qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. qyIs166 [cdh-3p::GFP::CAAX + unc-119(+)] X. Temperature-sensitive sterile; maintain at 20C or lower for optimum fertility. Increased sensitivity to RNAi when compared to wild-type animals. lam-1p::lam-1::mCherry expression can be weak and variable. Reference: Kelley, LC, et al. Developmental Cell. 2019 Feb 11;48(3):313-328.e8. |
| NK1531 | unc-119(ed4) III; qyIs366 V. | C. elegans | qyIs366 [ser-2(prom3)::hpo-30::GFP + unc-119(+)] V. Reporter allows visualization of HPO-30 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140. |
| NK1532 | qyIs368 I; unc-119(ed4) III. | C. elegans | qyIs368 [ser-2(prom3)::dma-1::GFP + unc-119(+)] I. Reporter allows visualization of DMA-1 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140. |
| NK2009 | dgn-1(qy206[dgn-1::GFP]) X. | C. elegans | GFP tag inserted into the C-terminus of the endogenous dgn-1 locus. |
| NK2115 | cpIs121 I; rrf-3(pk1426) II; rde-1(ne219) V. | C. elegans | cpIs121 [lag-2p::mNG::PH::F2A::rde-1] I. Temperature-sensitive: maintain at 16-20C. RNAi-response variant. RNAi-hypersensitized DTC-specific RNAi strain that labels all rde-1(+) cells with mNeonGreen. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284. |
| NK2225 | unc-59(qy50[unc-59::GFP::3xflag::AID*]) I. | C. elegans | CRISPR/Cas9-engineered insertion of GFP::3xflag::AID* tags into endogenous unc-59/septin locus. Reference: Chen D et al. MicroPubl Biol. 2019 Dec 20;2019:10.17912/micropub.biology.000200. doi: 10.17912/micropub.biology.000200. PMID: 32550451. |
| NK2318 | dgn-1(qy18[dgn-1::mNG]) X. | C. elegans | Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124. |
| NK2322 | cle-1(qy22[cle-1::mNG+loxP]) I. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2324 | ina-1(qy23[ina-1::mNG]) III. | C. elegans | Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124. |
| NK2326 | emb-9(qy24[emb-9::mNG+loxP]) III. | C. elegans | Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2335 | lam-2(qy20[lam-2::mNG+LoxP]) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124. |
| NK2353 | agr-1 (qy27[agr-1::mNG+loxP]) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2404 | epi-1(qy31[epi-1::mNG+loxP]) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2413 | sdn-1(qy29[sdn-1::mNG+loxP]) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2422 | him-4(qy33[him-4::mNG+loxP]) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2425 | lam-3(qy28[lam-3::mNG+loxP]) I. | C. elegans | Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2436 | pat-3(qy36[pat-3::mNG]) III. | C. elegans | Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124. |
| NK2442 | mig-6(qy37[mNG+loxP::mig-6]) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. mNeonGreen is inserted at the N-terminus right before a putative proprotein convertase cleavage site and Western analysis indicates most of the mNeonGreen is cut from the MIG-1 protein and is diffuse in the extracellular fluid. See Figure S1 in Keeley et al., Dev Cell. 2020 Jul 6;54(1):60-74.e7. doi: 10.1016/j.devcel.2020.05.022. PMID: 32585132 |
| NK2443 | nid-1(qy38[nid-1::mNG+loxP]) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2444 | pxn-2(qy39[pxn-2::mNG+loxP]) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2445 | pxn-1(qy40[pxn-1::mNG+loxP]) V. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2446 | lam-2(qy41[lam-2::mKate2]) X. | C. elegans | Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124. |
| NK2456 | ddr-1(qy43[ddr-1::mNG+loxP]) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2457 | ddr-2(qy44[ddr-2::mNG+loxP]) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2476 | ina-1(qy46[ina-1::mKate+loxP]) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mKate. Insertion site verified by PCR and sequencing. |
| NK2477 | ptp-3(qy47[ptp-3::mNG+loxP]) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2478 | deb-1(qy48[deb-1::mNG + LoxP]) IV. | C. elegans | CRISPR/Cas9 insertion of mNeonGreen tag into endogenous deb-1 locus. Low penetrance Rup and Pvl. Reference: Park K, et al. eLife. 2023 Jul 5;12:RP87037. doi: 10.7554/eLife.87037. PMID: 37405383. |
| NK2479 | pat-2(qy49[pat-2::2xmNG]) III. | C. elegans | Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124. |
| NK248 | unc-119(ed4) III; qyIs10 IV. | C. elegans | qyIs10 [lam-1p::lam-1::GFP + unc-119(+)]. Reference: Ziel JW, et al. Nat Cell Biol. 2009 Feb;11(2):183-9. |
| NK2500 | unc-52(qy53[unc-52::mNG+loxP]) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2502 | ten-1(qy56[ten-1::mNG+loxP]) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2503 | rap-3(qy57[rap-3::mNG]) IV. | C. elegans | Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124. |
| NK2511 | ddr-2(qy64[LoxP]) X. | C. elegans | CRISPR-engineered deletion of ddr-2. Low penetrance Rup. Reference: Park K, et al. eLife. 2023 Jul 5;12:RP87037. doi: 10.7554/eLife.87037. PMID: 37405383. |
| NK2540 | fdgt-1(qy65[fgt-1::mNG +loxP]) II. | C. elegans | Superficially wild-type. mNG tag inserted into the endogenous fgt-1 locus. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2555 | unc-52(qy75[mNG+loxP::unc-52]) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2557 | mig-6(qy73[mig-6::mNG+loxP]) V. | C. elegans | Superficially wild-type. Specifically tags the long isoform of mig-6. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2565 | pxn-2(qy76[mNG+loxP::pxn-2]) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2579 | fbl-1(qy62[mNG+loxP::fbl-1]) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2580 | spon-1(qy30[spon-1::mNG+loxP]) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2581 | gpn-1(qy35[gpn-1::mNG+loxP]) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2582 | lon-2(qy55[lon-2::mNG+loxP]) X. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2583 | unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2585 | emb-9(qy83[emb-9::mRuby2 + LoxP]) III. | C. elegans | mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2590 | gon-1(qy45[gon-1::mNG+loxP]) IV. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2604 | emb-9 (qy89[emb-9::mEos2+loxP]) III. | C. elegans | Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
| NK2609 | qyIs50 V; qyIs550. | C.elegans | qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. qyIs550 [zmp-1p::MLS::GFP + unc-119(+)]. Superficially wild-type animals expressing mitochondrial GFP and red F-actin in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2617 | qyIs23 II; IqIs80 IV. | C. elegans | qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. Utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214. |
| NK2621 | eif-1.A(qy90[eif-1.A::mNG]) IV. | C. elegans | mNG tag inserted into the C-terminus of the endogenous eif-1.A locus. |
| NK2623 | ucr-2.1(qy92[ucr-2.1::mNG]) X. | C. elegans | mNeonGreen tag inserted into the endogenous ucr-2.1 locus (C-terminus tag). Insertion verified by PCR. Left flanking sequence: 5' TCAGAAGGAACGACTCGTTG 3' ; Right flanking sequence: 5' CGAAAGTAGAATGCTAGTCAAG 3'. sgRNA: 5' TTTATAGCTCGTCGAGATAT 3'. Superficially wild-type. |
| NK2628 | unc-119(ed4) III; qyIs552. | C. elegans | qyIs552 [lin-29p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of ratiometric ATP:ADP biosensor PercevalHR. |
| NK2629 | fdgt-1(tm3165) qyIs23 II; qyIs10 IV. | C. elegans | qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. qyIs10 [lam-1p::lam-1::GFP + unc-119(+)] IV. fdgt-1 formerly known as fgt-1. Reference: Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2631 | qySi99 I; unc-6(ev400) X. | C.elegans | qySi99 [lin-29p::fdgt-1::mNG + loxP] I. Unc. Single-copy insertion. unc-6 mutant expressing anchor cell specific fdgt-1 glucose transporter. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell 2022 March 21. https://doi.org/10.1016/j.devcel.2022.02.019 |
| NK2632 | qySi99 I. | C. elegans | qySi99 [lin-29p::fdgt-1::mNG] I. Single-copy insertion of mNG-tagged fdgt-1. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2633 | elo-1(qy97[elo-1::mNG]) IV. | C. elegans | mNG tag inserted into the C-terminus of the endogenous elo-1 locus. |
| NK2635 | fdgt-1(tm3165) II; qyIs50 V. | C. elegans | qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. fdgt-1(tm3165) null mutant expressing an anchor cell specific F-actin marker. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2636 | fasn-1(qy98[fasn-1::mNG]) I. | C. elegans | fasn-1 locus endogenously tagged with mNG at the C-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK2637 | unc-119(ed4) III; qyIs553 | C. elegans | qyIs553 [lin-29p::ceGreenGlifon4000 +unc-119(+)]. Superficially wild-type strain expressing green glucose biosensor in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2639 | fdgt-1(tm3165) II; qyIs50 V; qyIs550. | C.elegans | qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. qyIs550 [zmp-1p::MLS::GFP + unc-119(+)]. fdgt-1 glucose transporter null mutants (tm3165) expressing anchor cell specific mitochondrial matrix localized GFP and F-actin mCherry. Useful for analyzing mitochondrial localization, morphology and dynamics in the absence of glucose import. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2643 | lin-35(n745) I; unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. | C. elegans | CRISPR/Cas9 insertion of mNeonGreen into the endogenous unc-52 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214. |
| NK2644 | lin-35(n745) I; fbl-1(qy62[mNG+loxP::fbl-1]) IV. | C. elegans | CRISPR/Cas9 insertion of mNeonGreen into the endogenous fbl-1 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214. |
| NK2645 | lin-35(n745) I; him-4(qy33[him-4::mNG+loxP]) X. | C. elegans | CRISPR/Cas9 insertion of mNeonGreen into the endogenous him-4 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214. |
| NK2651 | lin-35(n745) I; emb-9(qy83[emb-9::mRuby2 + LoxP]) III. | C. elegans | CRISPR/Cas9 insertion of mRuby2G into the endogenous emb-9 locus (internal tag) in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214. |
| NK2657 | nuo-1(qy143[nuo-1::mNG]) II; unc-119(ed4) III; qyIs50 V. | C. elegans | qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. Anchor cell specific red F-actin marker. mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'. |
| NK2667 | F26E4.7(qy103[F26E4.7::mNG + LoxP]) I. | C. elegans | mNG tag inserted into the endogenous F26E4.7 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2668 | C16E9.1(qy104[C16E9.1::mNG + LoxP]) X. | C. elegans | mNG tag inserted into the endogenous C16E9.1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2669 | F26E4.3(qy105[F26E4.3::mNG + LoxP]) I. | C. elegans | mNG tag inserted into the endogenous F26E4.3 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2672 | unc-40(qy68[unc-40::mNG + LoxP]) IV. | C. elegans | mNG tag inserted into the endogenous unc-40 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2673 | unc-5(qy70[unc-5::2xmNG + LoxP]) IV. | C. elegans | 2x mNG tag inserted into the endogenous unc-5 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2688 | fbn-1(qy107[fbn-1::mNG (internal tag) + LoxP]) III. | C. elegans | mNG tag inserted into the endogenous fbn-1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2689 | lin-35(n745) I; qyIs23 II; IqIs80 IV. | C. elegans | qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. RNAi sensitized strain with utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214. |
| NK2692 | test-1(qy108[test-1::mNG + LoxP]) IV. | C. elegans | mNG tag inserted into the endogenous test-1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2694 | bmdSi15 rpl-31(qy110[rpl-31::gfp11]) I. | C. elegans | bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus. |
| NK2698 | sax-3(qy113[sax-3::mNG + LoxP]) X. | C. elegans | mNG tag inserted into the endogenous sax-3 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2700 | eva-1(qy114[eva-1::mNG + LoxP]) I. | C. elegans | mNG tag inserted into the endogenous eva-1 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2701 | nas-39(qy115[nas-39::mNG + LoxP]) X. | C. elegans | mNG tag inserted into the endogenous nas-39 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2702 | C48E7.6(qy116[C48E7.6::mNG + LoxP]) I. | C. elegans | mNG tag inserted into the endogenous C48E7.6 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2704 | cpi-2(qy117[cpi-2::mNG + LoxP]) V. | C. elegans | mNG tag inserted into the endogenous cpi-2 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2705 | col-99(qy118[col-99::mNG (internal tag) + LoxP]) IV. | C. elegans | mNG tag inserted into the endogenous col-99 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2706 | col-99(qy119[col-99::mNG + LoxP]) IV. | C. elegans | mNG tag inserted into the endogenous col-99 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2721 | qySi569 I. | C. elegans | qySi569 [cdh-3p::fdgt-2::mNG + loxP] I. Superficially wild type animal expressing a single copy insertion of glucose transporter fdgt-2 in the anchor cell. fdgt-2 formerly known as fgt-2. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2728 | cpi-1(qy127[cpi-1::mNG + LoxP]) IV. | C. elegans | mNG tag inserted into the endogenous nas-39 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2730 | rpl-4(qy128[rpl-4::gfp11]) bmdSi15 I. | C. elegans | bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-41 locus. |
| NK2738 | cox-5A(qy136[cox-5A::mNG]) III. | C. elegans | mNeonGreen tag inserted into C-terminus of endogenous cox-5A locus. Slightly delayed growth. Insertion verified by PCR. Left flanking sequence: 5' GGTAACATGGCCTCGTTGACC 3' ; Right flanking sequence: 5' ATATTAGGAGGTCTCAGAGGAG 3'. sgRNA: 5' AAGAAGTGGTACAAGGACTA 3'. |
| NK2739 | cox-5B(qy137[cox-5B::mNG]) I. | C. elegans | mNeonGreen tag inserted into C-terminus of endogenous cox-5B locus. Insertion verified by PCR. Left flanking sequence: 5' TACAGCATGTGTAGACAACGAG 3' ; Right flanking sequence: 5' AAAGATGCGCACACAGACACA 3'. sgRNA: 5' TGTTTAGATGGATTCTGGGT 3'. Superficially wild-type. |
| NK2743 | cox-10(qy141[cox-10::mNG]) II. | C. elegans | mNeonGreen tag inserted into C-terminus of endogenous mNeonGreen tag inserted into C-terminus of endogenous cox-10 locus. Insertion verified by PCR. Left flanking sequence: 5' GGCACTCACATTTTCGCGTTA 3' ; Right flanking sequence: 5' TGAAGCGCGTCTAACACGTT 3'. sgRNA: 5' GAACGGCTACAACAAAATGG 3'. Superficially wild-type. |
| NK2746 | sdhb-1(qy144[sdhb-1::mNG]) II. | C. elegans | mNeonGreen tag inserted into C-terminus of endogenous sdhb-1 locus. Animals are slow growing with reduced brood size. Insertion verified by PCR. Left flanking sequence: 5' AACTGATGATGTAGCCGCCAAG 3' ; Right flanking sequence: 5' CAGTGAAAGTGCGTGTAGGA 3'. sgRNA: 5' ATCTCTCCGATGGCCTTAGC 3'. |
| NK2751 | T19D12.6(qy149[T19D12.6::mNG + LoxP]) II. | C. elegans | mNG tag inserted into the endogenous T19D12.6 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2752 | qyIs555. | C. elegans | qyIs555 [cdh-3p::aman-2::GFP]. Anchor cell specific expression of golgi protein aman-2. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK2756 | qyIs562. | C. elegans | qyIs562 [zmp-1p::zmp-1sp::sfGFP::KDEL]. Anchor cell specific expression of KDEL ER lumen marker. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK2764 | adm-4(qy153[adm-4::mNG + LoxP]) X. | C. elegans | mNG tag inserted into the endogenous adm-4 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2765 | qySi120[eef-1A.1p::iATPSnFR1.0::unc-54 3'UTR] I. | C. elegans | Superfically wild-type strain with ubiquitous somatic expression of ATP biosensor iATPSnFR1.0 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal iATPSnFR1.0 reverse primer: 5' CTTCATCTCGGCGACGGAGAGACGGTT 3' |
| NK2777 | nuo-1(qy157[nuo-1::mKate2]) II. | C. elegans | mKate2 tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'. |
| NK2779 | fdgt-1(tm3165) II; qyIs553. | C.elegans | qyIs553 [lin-29p::ceGreenGlifon4000 +unc-119(+)]. fdgt-1(tm3165) null mutant strain expressing green glucose biosensor in the anchor cell. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2780 | qySi564 I. | C. elegans | qySi564 [lin-29p::pfk-1.1::mNG +loxP] I. Single-copy insertion. Anchor cell-specific expression of the mNG-tagged glycolytic enzyme PFK-1.1 forms localized puncta at the site of invasion. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2781 | qySi565 I. | C. elegans | qySi565 [lin-29p::pyk-1a::mNG + loxP] I. Single-copy insertion. Anchor cell-specific expression of the mNG-tagged glycolytic enzyme PYK-1A forms puncta at the site of invasion. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2782 | qySi566 I. | C.elegans | qySi566 [lin-29p::enol-1a::mNG + loxP] I. Single-copy insertion. Anchor cell specific expression of glycolytic enzyme enol-1a which forms puncta at the invasive side and is also expressed in the nucleus. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2783 | qySi567 I. | C. elegans | qySi567 [ced-10p::pyk-1a::mNG + loxP] I. Single-copy insertion. Glycolytic enzyme pyk-1a expressed under the ced-10 promoter which shows uterine expression and forms clusters only in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2784 | trak-1(qy158[trak-1::mNG + loxP]) I. | C. elegans | trak-1 locus endogenously tagged with mNG at the C-terminus. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2785 | qySi569 I; fdgt-1(tm3165) II. | C.elegans | qySi569 [cdh-3p::fdgt-2::mNG + loxP] I. fdgt-1 glucose transporter null mutant expressing a single copy insertion of the glucose transporter fgt-2 in the anchor cell. fdgt-1 and fdgt-2 formerly known as fgt-1 and fgt-2, respectively. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2789 | bmdSi15 I; shy61(sec-61.B::GFP11x2) IV. | C. elegans | bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). 2x split GFP tag (GFP11) inserted into the C-terminus of the endogenous sec-61.B locus. |
| NK2790 | qySi121 I. | C. elegans | qySi121 [eef-1A.1p::GFP] I. MosSCI insertion. |
| NK2794 | fdgt-1(qy65[fdgt-1::mNG + loxP]) II; unc-6(ev400) X. | C.elegans | mNG tag inserted into the endogenous fdgt-1 locus. Unc. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 |
| NK2799 | unc-119(ed4) III; qyIs570 X. | C. elegans | qyIs570 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)] X. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP. |
| NK2800 | tct-1(qy161[tct-1::mNG]) I. | C. elegans | mNG tag inserted into the C-terminus of the endogenous tct-1 locus. |
| NK2811 | F25H2.6(qy162[F25H2.6::mNG + LoxP]) I. | C. elegans | mNG tag inserted into the endogenous F25H2.6 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. |
| NK2827 | snb-1(qy164[snb-1::mNG]) V. | C. elegans | mNG tag inserted into the C-terminus of the endogenous snb-1 locus. |
| NK2840 | mev-1(qy169[mev-1::mNG]) III. | C. elegans | mNeonGreen tag inserted into C-terminus of endogenous mev-1 locus. Animals are slow growing with reduced brood size. Insertion verified by PCR. Left flanking sequence: 5' TATCCAGACAAACCATAGGACT 3' ; Right flanking sequence: 5' GCCGAACGAGATTAGACCTAT 3'. sgRNA: 5' CAAGAGCAACAAGACTGCCT 3'. |
| NK2841 | nduf-7(qy170[nduf-7::mNG]) I. | C. elegans | mNeonGreen tag inserted into C-terminus of endogenous nduf-7 locus. Insertion verified by PCR. Left flanking sequence: 5' GCCGATTTGATTTTCGTTGCCG 3' ; Right flanking sequence: 5' GGCGAATTTGAATGGTCCAGT 3'. sgRNA: 5' GTAAGCGAGAAGCTCAACTT 3'. |
| NK2844 | cox-6A(qy173[cox-6A::mNG]) III. | C. elegans | mNeonGreen tag inserted into C-terminus of endogenous cox-6A locus. Insertion verified by PCR. Left flanking sequence: 5' AAGGTATCCGACATGAACCGT 3' ; Right flanking sequence: 5' CCATTCAAGCTTTACAGGGTTC 3'. sgRNA: 5' TCAGCCTCGAATCCAACTCC 3'. |
| NK2845 | nduv-2(qy174[nduv-2::mNG]) V. | C. elegans | mNeonGreen tag inserted into C-terminus of endogenous nduv-2 locus. Insertion verified by PCR. Left flanking sequence: 5' AGATGTCGTTGGCATCGAACGT 3' ; Right flanking sequence: 5' CTTGATCGGTGGTGATAGCTGA 3'. sgRNA: 5' GCTGCTCTTAAATAAACGCT 3'. |
| NK2864 | qySi180 I. | C. elegans | qySi180 [lin-29p::GFP::CAAX] I. MosSCI single copy insertion. Anchor cell specific expression of CAAX motif. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK2902 | bmdSi15 I; rpl-31(qy189[rpl-31::ZF1::GFP11]) I; zif-1(gk117) III; qyIs463. | C. elegans | qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3' UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3' UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus. L4-specific expression of ZIF-1, ubiquitous GFPbeta1-10 and endogenous rpl-31 tagged with ZF-1+GFP-beta11 |
| NK2920 | emb-9(qy83[emb-9::mRuby2 + LoxP]) III; gon-1(qy45[gon-1::mNG+loxP]) IV. | C. elegans | CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus and mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214. |
| NK2922 | lin-35(n745) I; gon-1(qy45[gon-1::mNG+loxP]) IV. | C. elegans | CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214. |
| NK2925 | sms-1(qy198[sms-1::mNG]) IV. | C. elegans | sms-1 locus endogenously tagged with mNG at the C-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK2929 | fnta-1(qy199[fnta-1::mNG]) IV. | C. elegans | fnta-1 locus endogenously tagged with mNG at the C-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK2935 | hmgr-1(qy202[mNG::hmgr-1]) III. | C. elegans | hmgr-1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK2936 | unc-6(cp190[unc-6::mNG::3xFLAG + LoxP]) X. | C. elegans | mNG and 3xFlag tags inserted into the endogenous unc-6 locus. Superficially wild-type. Reference: Naegeli KM, et al. Dev Cell. 2017 Nov 20;43(4):403-417.e10. doi: 10.1016/j.devcel.2017.10.024. PMID: 29161591 |
| NK2943 | hmgr-1(qy202[mNG::hmgr-1]) III; unc-6(ev400) X. | C. elegans | hmgr-1 locus endogenously tagged with mNG at the N-terminus in unc-6 mutant background. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK2949 | qySi205 I. | C. elegans | qySi205 [lin-29p::icmt-1::mscarlet] I. MosSCI single copy insertion. Anchor cell specific expression of prenylation enzyme icmt-1. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK2959 | rrf-3(pk1426) II; sms-1(qy198[sms-1::mNG]) IV. | C. elegans | Maintain at 20C or lower. sms-1 locus endogenously tagged with mNG at the C-terminus in rrf-3 mutant background. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK2961 | rf-3(pk1426) II; qyIs550. | C. elegans | qyIs550 [zmp-1p::MLS::GFP]. |
| NK2962 | rrf-3(pk1426) II; zmp-1(qy17[zmp-1::mNG::GPI]) III. | C. elegans | mNG and GPI tags inserted into the C-terminus of the endogenous zmp-1 locus. |
| NK2964 | nifk-1(qy126[nifk-1::mNG]) zmp-1(cg115) III. | C. elegans | mNG tag inserted into the C-terminus of the endogenous nifk-1 locus. |
| NK2966 | qySi205 I; unc-6(ev400) X. | C. elegans | qySi205 [lin-29p::icmt-1::mScarlet] I. unc-6 mutant expressing anchor cell specific prenylation enzyme icmt-1. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK2984 | let-2(qy216[let-2::mRuby2]) X. | C. elegans | mRuby2 tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062. |
| NK2987 | let-60(qy220[mNG::let-60 + LoxP]) IV. | C. elegans | CRISPR/Cas9 insertion of mNeonGreen tag into endogenous let-60 locus. Fairly high penetrance of L1 rod-like lethality. Reference: Jayadev et al. 2023. Post-embryonic endogenous expression and localization of LET-60/Ras in C. elegans. microPublication Biology. 10.17912/micropub.biology.000931. |
| NK2990 | qySi205; qyIs562. | C. elegans | qySi205 [lin-29p::icmt-1::mscarlet] I. qyIs562 [zmp-1p::zmp-1sp::sfGFP::KDEL]. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and anchor cell specific expression of KDEL ER lumen marker. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK2998 | rrf-3(pk1426) II; qyIs570. | C. elegans | qyIs570 [lin-29p::EMTB::GFP]. |
| NK3017 | fce-1(qy215[mNG::fce-1]) I. | C. elegans | fce-1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK3018 | mtx-1(qy217[mtx-1::mNG]) I. | C. elegans | mNeonGreen tag inserted into C-terminus of endogenous mtx-1 locus. Insertion verified by PCR. Left flanking sequence: 5' ATGGAATTACACATTTGGCCG 3' ; Right flanking sequence: 5' TGTTGAGGATCTTTCTTCCT 3'. sgRNA: 5' GACTGACACTTGAATCAGACA 3'. |
| NK3019 | qySi218[rpl-28p::tomm-20::mKate2::3xHA::unc-54 3'UTR] I. | C. elegans | Superfically wild-type strain with ubiquitous expression of red mitochondria outermembrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. |
| NK3026 | let-2(qy228[let-2::mNG]) X. | C. elegans | mNG tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062. |
| NK3027 | qySi148 I; lam-2(qy20[lam-2::mNG]) IV. | C. elegans | qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. mNeonGreen tag inserted into C-terminus of endogenous lam-2 locus. Superfically wild-type strain with AC-specific plasma membrane marker and BM marker. BM visualized with endogenously tagged laminin. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. |
| NK3030 | qySi229 I. | C. elegans | qySi229 [cdh-3p::lmp-1::mNG] I. MosSCI single copy insertion. Anchor cell specific expression of lysosomal protein lmp-1. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK3047 | immt-1(qy230[immt-1::mNG]) X | C. elegans | mNeonGreen tag inserted into C-terminus of endogenous immt-1 locus. Insertion verified by PCR. Left flanking sequence: 5' GTCAATCCAGAAGACGAGTT 3' ; Right flanking sequence: 5' ATCGATGAGAACGGAGGAAC 3'. sgRNA: 5' CTAATAAGTTGAGCGAATCG 3'. |
| NK3055 | qySi147 I; sec-16A.1(qy234[mNG::sec16A.1]) III. | C. elegans | qySi147 [lin-29p::mKate2::PLC(delta)PH] I. qy234 [mNG::sec16A.1] III. sec16A.1 locus endogenously tagged with mNG at the N-terminus and MosSCI single copy insertion for anchor cell specific expression of membrane marker PLCδPH. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK3057 | emb-9(qy236[emb-9::mNG]) III. | C. elegans | mNG tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062. |
| NK3065 | qySi205 I; sec-16A.1(qy234[mNG::sec16A.1]) III. | C. elegans | qySi205 [lin-29p::icmt-1::mscarlet] I. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and sec-16A.1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK3066 | rrf-3(pk1426) II; qyIs221. | C. elegans | qyIs221 [cdh-3p::GFP::ced-10]. Maintain at 20C or lower. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK3072 | emb-9(qy244[emb-9::mRuby2]) III. | C. elegans | mRuby2 tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062. |
| NK3073 | emb-9(qy245[emb-9::mEos2]) III. | C. elegans | Photoconvertible mEos2 tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062. |
| NK3080 | cpIs91 II; sbp-1(qy94[mNG::sbp-1]) III. | C. elegans | cpIs91 [lag-2p::2x mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR LoxN] II. sbp-1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804. |
| NK3084 | mtx-2(qy248[mNG::mtx-2]) III. | C. elegans | mNeonGreen tag inserted into N-terminus of endogenous mtx-2 locus. Insertion verified by PCR. Left flanking sequence: 5' CTACAATTTGCCTGCCGATGA 3' ; Right flanking sequence: 5' TACCTCGACAGTGGTAAGAA 3'. sgRNA: 5' GACCAATTGGGTTATCACCC 3'. |
| NK3085 | cpIs91 II; immt-1(qy230[immt-1::mNG]) X. | C. elegans | cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous immt-1 locus. lag-2 driven red plasma membrane marker. |
| NK3086 | cpIs91 II; ucr-2.1(qy92[ucr-2.1::mNG]) X. | C. elegans | cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous ucr-2.1 locus. lag-2 driven red plasma membrane marker. |
| NK3087 | cpIs91 II; nduv-2(qy174[nduv-2::mNG]) V. | C. elegans | cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous nduv-2 locus. lag-2 driven red plasma membrane marker. |
| NK3114 | crls-1(qy255[crls-1::mNG]) III. | C. elegans | mNeonGreen tag inserted into C-terminus of endogenous crls-1 locus. Insertion verified by PCR. Left flanking sequence: 5' AGTCACTACCACCGGAAGAACG 3' ; Right flanking sequence: 5' CTTGGTTTCGGCACTGGTGTTTC 3'. sgRNA: 5' CGGGACTACAGTATGCCAGTAA 3'. |
| NK3189 | qySi275 I. | C. elegans | qySi275 [nduv-2p::mNG::P2A::mKate2::unc-54 3'UTR] I. nduv-2 transcriptional reporter fused to mNeonGreen and mKate2. Inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type. |
| NK3210 | nuo-1(qy145[nuo-1::mNG]) II; emb-9(qy244[emb-9::mRuby2]) III. | C. elegans | mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. mRuby2 tag inserted into C-terminus of endogenous emb-9 locus. |
| NK3211 | nuo-1(qy145[nuo-1::mNG]) II; emb-9(qy244[emb-9::mRuby2]) III; unc-6(ev400) X. | C. elegans | mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. mRuby2 tag inserted into C-terminus of endogenous emb-9 locus. Unc-6 netrin mutation causes reduced movement and protruding vulva (Pvl) phenotype. |
| NK3212 | cox-4(qy134[cox-4::mNG]) I. | C. elegans | mNeonGreen tag inserted into C-terminus of endogenous cox-4 locus. Insertion verified by PCR. Left flanking sequence: 5' CACGAAGAGAGAACGGTTTTTGA 3' ; Right flanking sequence: 5' TCGACTGGAAACTCTCGAAGGT 3'. sgRNA: 5' TTCTCGTAATCGTAGTGTGT 3'. Superficially wild-type. |
| NK3229 | unc-119(ed4) III; qyIs629. | C. elegans | qyIs629 [eef-1A.1p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Ubiquitous somatic expression of ratiometric ATP:ADP biosensor PercevalHR. |
| NK3234 | cpIs91 II; crls-1(qy255[crls-1::mNG]) III. | C. elegans | cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous crls-1 locus. lag-2 driven red plasma membrane marker. |
| NK3236 | qySi252 [let-2p::mNG] I. | C. elegans | qySi252 [let-2p::mNG] I. Single-copy CRISPR-based integration into ttTi4348. Wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062. |
| NK3237 | let-2(qy286[let-2::P2A::PEST::mNG]) X. | C. elegans | Endogenous reporter of type IV collagen alpha chain (let-2) translation. mNG tag inserted at the endogenous C-terminus locus with a P2A sequence between the C-terminus of let-2 and mNG. P2A causes let-2 to be translated independently of mNG. Cytosolic mNG is a reporter of translation. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062. |
| NK3238 | emb-9(qy287[emb-9::P2A::PEST::mNG]) III. | C. elegans | Endogenous reporter of type IV collagen alpha chain (emb-9) translation. mNG tag inserted at the endogenous C-terminus locus with a P2A sequence between the C-terminus of emb-9 and mNG. P2A causes emb-9 to be translated independently of mNG. Cytosolic mNG is a reporter of translation. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062. |
| NK3240 | emb-9(qy288[emb-9 (G1173D)::mNG]) III. | C. elegans | Endogenously tagged temperature sensitive glycine substitution mutant allele (b117) of emb-9. Tagged with mNG at the C-terminus. Temperature sensitive. Semi-dominant. Egg lethal. Not maternal. Will grow at 20C. See also CGC DH117. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062. |
| NK3241 | let-2(qy289[let-2 (G1287D)::mNG]) X. | C. elegans | Endogenously tagged temperature sensitive glycine substitution mutant allele (b246) of let-2. Tagged with mNG at the C-terminus. Temperature sensitive embryonic lethal. Grows at 15C, 20C. Lethal at 25C (embryonic). See also CGC DH246. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062. |
| NK3242 | let-2(qy290[let-2::mMaple]) X. | C. elegans | Photoconvertible mMaple tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062. |
| NK3255 | mtx-2(qy248[mNG::mtx-2]) III; unc-6(ev400) X. | C. elegans | mNeonGreen tag inserted into N-terminus of endogenous mtx-2 locus in netrin null mutant background (ev400). |
| NK3271 | qySi296 I. | C. elegans | qySi296 [eef-1A.1p::SL2::HYlight::tbb-2 3'UTR] I. Ubiquitous somatic expression of glycolysis ratiometric biosensor HYlight inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. |
| NK3281 | unc-119(ed4) III; unc-6(ev400) X; qyIs552. | C. elegans | qyIs552 [lin-29p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of ratiometric ATP:ADP biosensor PercevalHR. netrin null mutant background (ev400). |
| NK3299 | qySi312 I. | C. elegans | qySi312 [eef-1A.1p::SL2::HYlight-RA::tbb-2 3'UTR] I. Ubiquitous somatic expression of glycolysis ratiometric biosensor Hylight-reduced affinity (RA) control inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. |
| NK3304 | qySi313 I; unc-119(ed4) III; qyIs629. | C. elegans | qySi313 [lin-29p::ucp-4::SL2::mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR] I. qyIs629 [eef-1A.1p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Ubiquitous somatic expression of ratiometric ATP:ADP biosensor PercevalHR. Anchor cell specific overexpression of mitochondrial uncoupling protein, UCP-4, (expression confirmed by presence of red anchor cell membrane). qySi313 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. |
| NK3306 | unc-119(ed4) III; unc-6(ev400) X; qyIs636. | C. elegans | qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP in netrin null mutant background (ev400). |
| NK3314 | qySi148 I; unc-119(ed4) III; qyIs636. | C. elegans | qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. |
| NK3325 | qySi316 I. | C. elegans | qySi316 [nuo-1p::mNG::P2A::mKate2::unc-54 3'UTR] I. Transcriptional nuo-1 reporter fused to mNeonGreen and mKate2 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type. |
| NK358 | unc-119(ed4) III; qyIs43. | C. elegans | qyIs43 [pat-3::GFP + ina-1(genomic) + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: Hagedorn et al., Dev Cell (2009) Aug 17(2):187-98. |
| NK364 | unc-119(ed3) III; qyIs46. | C. elegans | qyIs46 [emb-9p::emb-9::mCherry + unc-119(+)] X. Superficially wild-type with very low penetrance (~5%) rupture. Integrated collagen::mCherry reporter. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51. |
| NK413 | rrf-3(pk1426) II; qyIs50 V. | C. elegans | qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. |
| NK564 | unc-119(ed4) III; qyEx78. | C. elegans | qyEx78 [Venus::unc-6(deltaSP) + unc-119(+)]. Maintain by picking non-Unc. |
| NK640 | rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs102. | C. elegans | qyIs102 [fos-1ap::rde-1(genomic) + myo-2::YFP + unc-119(+)]. Uterine-specific RNAi. |
| NK651 | unc-119(ed4) III; qyIs108. | C. elegans | qyIs108 [lam-1p::lam-1::Dendra + unc-119(+)]. High expression in basement membranes; cleaner laminin-dendra expression than NK652. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51. |
| NK652 | unc-119(ed4) III; qyIs109. | C. elegans | qyIs109 [lam-1p::lam-1::Dendra + unc-119(+)]. High expression in basement membranes, also accumulates in body wall muscle. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51. |
| NK696 | unc-119(ed4) III; qyIs127. | C. elegans | qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51. |
| NK741 | rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs138. | C. elegans | qyIs138 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion. |
| NK742 | rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs139. | C. elegans | qyIs139 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion. |
| NK772 | unc-119(ed4) III; qyEx115. | C. elegans | qyEx115 [C11D9.1::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK773 | unc-119(ed4) III; qyEx114. | C. elegans | qyEx114 [C28C12.10::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK774 | unc-119(ed4) III; qyEx116. | C. elegans | qyEx116 [C14A11.3b::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK775 | unc-119(ed4) III; qyEx117. | C. elegans | qyEx117 [C14A11.3a,c::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK776 | unc-119(ed4) III; qyEx118. | C. elegans | qyEx118 [exc-5::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK777 | unc-119(ed4) III; qyEx121. | C. elegans | qyEx121 [F55C7.7d::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK778 | unc-119(ed4) III; qyEx120. | C. elegans | qyEx120 [F55C7.7c::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK779 | unc-119(ed4) III; qyEx119. | C. elegans | qyEx119 [F13E6.6::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK780 | unc-119(ed4) III; qyEx122. | C. elegans | qyEx122 [F55C7.7e::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK781 | unc-119(ed4) III; qyEx123. | C. elegans | qyEx123 [K07D4.7a::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK782 | unc-119(ed4) III; qyEx124. | C. elegans | qyEx124 [pix-1::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK783 | unc-119(ed4) III; qyEx125. | C. elegans | qyEx125 [R02F2.2::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK784 | unc-119(ed4) III; qyEx126. | C. elegans | qyEx126 [T19E10.1::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK785 | unc-119(ed4) III; qyEx127. | C. elegans | qyEx127 [ced-5::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK786 | unc-119(ed4) III; qyEx128. | C. elegans | qyEx128 [F22G12.5::GFP + unc-119(+)]. Maintain by picking non-Unc. |
| NK860 | unc-119(ed4) III; qyIs161. | C. elegans | qyIs161 [emb-9p::emb-9::Dendra + unc-119(+)]. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51. |
| NK885 | unc-119(ed4) III; qyIs174. | C. elegans | qyIs174 [hlh-2p::GFP::hlh-2 + unc-119(+)]. Translational fusion protein displaying cytoplasmic and nuclear localization; contains 8 kb upstream, N-terminal GFP fusion, full open reading frame and 3'UTR. Reference: Schindler AJ, Sherwood DR. Dev Biol. 2011 Sep 15;357(2):380-91. |
| NK887 | unc-119(ed4) III; qyIs176. | C. elegans | qyIs176 [zmp-1(50-51)p::mCherry::moeABD + unc-119(+)]. Reference: Schindler AJ, Sherwood DR. Dev Biol. 2011 Sep 15;357(2):380-91. |
| PS4865 | unc-119(ed4) III; him-5(e1490) V; syEx684. | C. elegans | syEx684 [unc-119(+) + fos-1a/b::GFP-TL]. Ex line of functional fos-1 gene tagged with GFP at the C-terminus. Pick WT to maintain. Throws males. Do not distribute this strain; other labs should request it from the CGC. |
| RIE102 | unc-119(ed3) III; ftt-2(tm1486) X; atrIs1. | C. elegans | atrIs1 [ftt-2p::ftt-2::mCherry + unc-119(+)]. Line is slightly sick and burrows. FTT-2::mCherry fusion protein rescues ftt-2(tm1486) deletion mutant. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284. PMID: 28648843 |
| SBW292 | wow47(ebp-2::GFP::3xFLAG) II; qyIs250. | C. elegans | qyIs250 [exc-6p::mCherry::moesinABD]. GFP::3xFlag tags inserted into the C-terminus of the endogenous ebp-2 locus. |
This laboratory hasn't submitted any alleles to the CGC.