Laboratory Information

NameNK View on WormBase
Allele designationqy
HeadDavid Royal Sherwood
InstitutionDuke University, Durham, NC
Address 124 Science Dr.
FFSC4244
PO BOX 90338
Durham 27708-0338
United States
Website http://www.biology.duke.edu/sherwoodlab/Welcome.html
Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
DQM1152 bmdSi243 I; ljf3(unc-34::mNG-C1::3xFlag::AID*) V; qy41(lam-2::mKate2) X. C. elegans bmdSi243 (LoxN + cdh-3p::TIR1::F2A::DHB::2xmTurquoise2) I. bmdSi243 is a MosSCI insertion. mNG tag inserted into the C-temrinus of the endogenous unc-34 locus. mKate2 tag inserted into the C-temrinus of the endogenous lam-2 locus.
FDU1056 mig-17(shc19[mig-17::mNG +LoxP]) V. C. elegans C-terminus of endogenous mig-17 locus tagged with mNeonGreen using CRISPR/Cas9. Reference: Fan J, et al. Elife. 2020 Apr 7;9:e55890. PMID: 32255430
LP511 lin-3(cp226[lin-3::mNG::3xFLAG]) IV. C. elegans mNG and 3xFlag tags inserted into the C-terminus of the endogenous lin-3 locus.
NK1339 rrf-3(pk1426) II; qyIs127 V; qyIs166 X. C. elegans qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. qyIs166 [cdh-3p::GFP::CAAX + unc-119(+)] X. Temperature-sensitive sterile; maintain at 20C or lower for optimum fertility. Increased sensitivity to RNAi when compared to wild-type animals. lam-1p::lam-1::mCherry expression can be weak and variable. Reference: Kelley, LC, et al. Developmental Cell. 2019 Feb 11;48(3):313-328.e8.
NK1531 unc-119(ed4) III; qyIs366 V. C. elegans qyIs366 [ser-2(prom3)::hpo-30::GFP + unc-119(+)] V. Reporter allows visualization of HPO-30 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140.
NK1532 qyIs368 I; unc-119(ed4) III. C. elegans qyIs368 [ser-2(prom3)::dma-1::GFP + unc-119(+)] I. Reporter allows visualization of DMA-1 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140.
NK2009 dgn-1(qy206[dgn-1::GFP]) X. C. elegans GFP tag inserted into the C-terminus of the endogenous dgn-1 locus.
NK2115 cpIs121 I; rrf-3(pk1426) II; rde-1(ne219) V. C. elegans cpIs121 [lag-2p::mNG::PH::F2A::rde-1] I. Temperature-sensitive: maintain at 16-20C. RNAi-response variant. RNAi-hypersensitized DTC-specific RNAi strain that labels all rde-1(+) cells with mNeonGreen. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284.
NK2225 unc-59(qy50[unc-59::GFP::3xflag::AID*]) I. C. elegans CRISPR/Cas9-engineered insertion of GFP::3xflag::AID* tags into endogenous unc-59/septin locus. Reference: Chen D et al. MicroPubl Biol. 2019 Dec 20;2019:10.17912/micropub.biology.000200. doi: 10.17912/micropub.biology.000200. PMID: 32550451.
NK2318 dgn-1(qy18[dgn-1::mNG]) X. C. elegans Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK2322 cle-1(qy22[cle-1::mNG+loxP]) I. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2324 ina-1(qy23[ina-1::mNG]) III. C. elegans Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK2326 emb-9(qy24[emb-9::mNG+loxP]) III. C. elegans Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2335 lam-2(qy20[lam-2::mNG+LoxP]) X. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK2353 agr-1 (qy27[agr-1::mNG+loxP]) II. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2404 epi-1(qy31[epi-1::mNG+loxP]) IV. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2413 sdn-1(qy29[sdn-1::mNG+loxP]) X. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2422 him-4(qy33[him-4::mNG+loxP]) X. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2425 lam-3(qy28[lam-3::mNG+loxP]) I. C. elegans Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2436 pat-3(qy36[pat-3::mNG]) III. C. elegans Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK2442 mig-6(qy37[mNG+loxP::mig-6]) V. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. mNeonGreen is inserted at the N-terminus right before a putative proprotein convertase cleavage site and Western analysis indicates most of the mNeonGreen is cut from the MIG-1 protein and is diffuse in the extracellular fluid. See Figure S1 in Keeley et al., Dev Cell. 2020 Jul 6;54(1):60-74.e7. doi: 10.1016/j.devcel.2020.05.022. PMID: 32585132
NK2443 nid-1(qy38[nid-1::mNG+loxP]) V. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2444 pxn-2(qy39[pxn-2::mNG+loxP]) X. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2445 pxn-1(qy40[pxn-1::mNG+loxP]) V. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2446 lam-2(qy41[lam-2::mKate2]) X. C. elegans Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK2456 ddr-1(qy43[ddr-1::mNG+loxP]) X. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2457 ddr-2(qy44[ddr-2::mNG+loxP]) X. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2476 ina-1(qy46[ina-1::mKate+loxP]) III. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mKate. Insertion site verified by PCR and sequencing.
NK2477 ptp-3(qy47[ptp-3::mNG+loxP]) II. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2478 deb-1(qy48[deb-1::mNG + LoxP]) IV. C. elegans CRISPR/Cas9 insertion of mNeonGreen tag into endogenous deb-1 locus. Low penetrance Rup and Pvl. Reference: Park K, et al. eLife. 2023 Jul 5;12:RP87037. doi: 10.7554/eLife.87037. PMID: 37405383.
NK2479 pat-2(qy49[pat-2::2xmNG]) III. C. elegans Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK248 unc-119(ed4) III; qyIs10 IV. C. elegans qyIs10 [lam-1p::lam-1::GFP + unc-119(+)]. Reference: Ziel JW, et al. Nat Cell Biol. 2009 Feb;11(2):183-9.
NK2500 unc-52(qy53[unc-52::mNG+loxP]) II. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2502 ten-1(qy56[ten-1::mNG+loxP]) III. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2503 rap-3(qy57[rap-3::mNG]) IV. C. elegans Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK2511 ddr-2(qy64[LoxP]) X. C. elegans CRISPR-engineered deletion of ddr-2. Low penetrance Rup. Reference: Park K, et al. eLife. 2023 Jul 5;12:RP87037. doi: 10.7554/eLife.87037. PMID: 37405383.
NK2540 fdgt-1(qy65[fgt-1::mNG +loxP]) II. C. elegans Superficially wild-type. mNG tag inserted into the endogenous fgt-1 locus. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2555 unc-52(qy75[mNG+loxP::unc-52]) II. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2557 mig-6(qy73[mig-6::mNG+loxP]) V. C. elegans Superficially wild-type. Specifically tags the long isoform of mig-6. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2565 pxn-2(qy76[mNG+loxP::pxn-2]) X. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2579 fbl-1(qy62[mNG+loxP::fbl-1]) IV. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2580 spon-1(qy30[spon-1::mNG+loxP]) II. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2581 gpn-1(qy35[gpn-1::mNG+loxP]) X. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2582 lon-2(qy55[lon-2::mNG+loxP]) X. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2583 unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2585 emb-9(qy83[emb-9::mRuby2 + LoxP]) III. C. elegans mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2590 gon-1(qy45[gon-1::mNG+loxP]) IV. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2604 emb-9 (qy89[emb-9::mEos2+loxP]) III. C. elegans Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2609 qyIs50 V; qyIs550. C.elegans qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. qyIs550 [zmp-1p::MLS::GFP + unc-119(+)]. Superficially wild-type animals expressing mitochondrial GFP and red F-actin in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2617 qyIs23 II; IqIs80 IV. C. elegans qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. Utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2621 eif-1.A(qy90[eif-1.A::mNG]) IV. C. elegans mNG tag inserted into the C-terminus of the endogenous eif-1.A locus.
NK2623 ucr-2.1(qy92[ucr-2.1::mNG]) X. C. elegans mNeonGreen tag inserted into the endogenous ucr-2.1 locus (C-terminus tag). Insertion verified by PCR. Left flanking sequence: 5' TCAGAAGGAACGACTCGTTG 3' ; Right flanking sequence: 5' CGAAAGTAGAATGCTAGTCAAG 3'. sgRNA: 5' TTTATAGCTCGTCGAGATAT 3'. Superficially wild-type.
NK2628 unc-119(ed4) III; qyIs552. C. elegans qyIs552 [lin-29p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of ratiometric ATP:ADP biosensor PercevalHR.
NK2629 fdgt-1(tm3165) qyIs23 II; qyIs10 IV. C. elegans qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. qyIs10 [lam-1p::lam-1::GFP + unc-119(+)] IV. fdgt-1 formerly known as fgt-1. Reference: Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2631 qySi99 I; unc-6(ev400) X. C.elegans qySi99 [lin-29p::fdgt-1::mNG + loxP] I. Unc. Single-copy insertion. unc-6 mutant expressing anchor cell specific fdgt-1 glucose transporter. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell 2022 March 21. https://doi.org/10.1016/j.devcel.2022.02.019
NK2632 qySi99 I. C. elegans qySi99 [lin-29p::fdgt-1::mNG] I. Single-copy insertion of mNG-tagged fdgt-1. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2633 elo-1(qy97[elo-1::mNG]) IV. C. elegans mNG tag inserted into the C-terminus of the endogenous elo-1 locus.
NK2635 fdgt-1(tm3165) II; qyIs50 V. C. elegans qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. fdgt-1(tm3165) null mutant expressing an anchor cell specific F-actin marker. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2636 fasn-1(qy98[fasn-1::mNG]) I. C. elegans fasn-1 locus endogenously tagged with mNG at the C-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2637 unc-119(ed4) III; qyIs553 C. elegans qyIs553 [lin-29p::ceGreenGlifon4000 +unc-119(+)]. Superficially wild-type strain expressing green glucose biosensor in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2639 fdgt-1(tm3165) II; qyIs50 V; qyIs550. C.elegans qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. qyIs550 [zmp-1p::MLS::GFP + unc-119(+)]. fdgt-1 glucose transporter null mutants (tm3165) expressing anchor cell specific mitochondrial matrix localized GFP and F-actin mCherry. Useful for analyzing mitochondrial localization, morphology and dynamics in the absence of glucose import. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2643 lin-35(n745) I; unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. C. elegans CRISPR/Cas9 insertion of mNeonGreen into the endogenous unc-52 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2644 lin-35(n745) I; fbl-1(qy62[mNG+loxP::fbl-1]) IV. C. elegans CRISPR/Cas9 insertion of mNeonGreen into the endogenous fbl-1 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2645 lin-35(n745) I; him-4(qy33[him-4::mNG+loxP]) X. C. elegans CRISPR/Cas9 insertion of mNeonGreen into the endogenous him-4 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2651 lin-35(n745) I; emb-9(qy83[emb-9::mRuby2 + LoxP]) III. C. elegans CRISPR/Cas9 insertion of mRuby2G into the endogenous emb-9 locus (internal tag) in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2657 nuo-1(qy143[nuo-1::mNG]) II; unc-119(ed4) III; qyIs50 V. C. elegans qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. Anchor cell specific red F-actin marker. mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'.
NK2667 F26E4.7(qy103[F26E4.7::mNG + LoxP]) I. C. elegans mNG tag inserted into the endogenous F26E4.7 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2668 C16E9.1(qy104[C16E9.1::mNG + LoxP]) X. C. elegans mNG tag inserted into the endogenous C16E9.1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2669 F26E4.3(qy105[F26E4.3::mNG + LoxP]) I. C. elegans mNG tag inserted into the endogenous F26E4.3 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2672 unc-40(qy68[unc-40::mNG + LoxP]) IV. C. elegans mNG tag inserted into the endogenous unc-40 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2673 unc-5(qy70[unc-5::2xmNG + LoxP]) IV. C. elegans 2x mNG tag inserted into the endogenous unc-5 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2688 fbn-1(qy107[fbn-1::mNG (internal tag) + LoxP]) III. C. elegans mNG tag inserted into the endogenous fbn-1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2689 lin-35(n745) I; qyIs23 II; IqIs80 IV. C. elegans qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. RNAi sensitized strain with utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2692 test-1(qy108[test-1::mNG + LoxP]) IV. C. elegans mNG tag inserted into the endogenous test-1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2694 bmdSi15 rpl-31(qy110[rpl-31::gfp11]) I. C. elegans bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus.
NK2698 sax-3(qy113[sax-3::mNG + LoxP]) X. C. elegans mNG tag inserted into the endogenous sax-3 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2700 eva-1(qy114[eva-1::mNG + LoxP]) I. C. elegans mNG tag inserted into the endogenous eva-1 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2701 nas-39(qy115[nas-39::mNG + LoxP]) X. C. elegans mNG tag inserted into the endogenous nas-39 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2702 C48E7.6(qy116[C48E7.6::mNG + LoxP]) I. C. elegans mNG tag inserted into the endogenous C48E7.6 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2704 cpi-2(qy117[cpi-2::mNG + LoxP]) V. C. elegans mNG tag inserted into the endogenous cpi-2 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2705 col-99(qy118[col-99::mNG (internal tag) + LoxP]) IV. C. elegans mNG tag inserted into the endogenous col-99 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2706 col-99(qy119[col-99::mNG + LoxP]) IV. C. elegans mNG tag inserted into the endogenous col-99 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2721 qySi569 I. C. elegans qySi569 [cdh-3p::fdgt-2::mNG + loxP] I. Superficially wild type animal expressing a single copy insertion of glucose transporter fdgt-2 in the anchor cell. fdgt-2 formerly known as fgt-2. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2728 cpi-1(qy127[cpi-1::mNG + LoxP]) IV. C. elegans mNG tag inserted into the endogenous nas-39 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2730 rpl-4(qy128[rpl-4::gfp11]) bmdSi15 I. C. elegans bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-41 locus.
NK2738 cox-5A(qy136[cox-5A::mNG]) III. C. elegans mNeonGreen tag inserted into C-terminus of endogenous cox-5A locus. Slightly delayed growth. Insertion verified by PCR. Left flanking sequence: 5' GGTAACATGGCCTCGTTGACC 3' ; Right flanking sequence: 5' ATATTAGGAGGTCTCAGAGGAG 3'. sgRNA: 5' AAGAAGTGGTACAAGGACTA 3'.
NK2739 cox-5B(qy137[cox-5B::mNG]) I. C. elegans mNeonGreen tag inserted into C-terminus of endogenous cox-5B locus. Insertion verified by PCR. Left flanking sequence: 5' TACAGCATGTGTAGACAACGAG 3' ; Right flanking sequence: 5' AAAGATGCGCACACAGACACA 3'. sgRNA: 5' TGTTTAGATGGATTCTGGGT 3'. Superficially wild-type.
NK2743 cox-10(qy141[cox-10::mNG]) II. C. elegans mNeonGreen tag inserted into C-terminus of endogenous mNeonGreen tag inserted into C-terminus of endogenous cox-10 locus. Insertion verified by PCR. Left flanking sequence: 5' GGCACTCACATTTTCGCGTTA 3' ; Right flanking sequence: 5' TGAAGCGCGTCTAACACGTT 3'. sgRNA: 5' GAACGGCTACAACAAAATGG 3'. Superficially wild-type.
NK2746 sdhb-1(qy144[sdhb-1::mNG]) II. C. elegans mNeonGreen tag inserted into C-terminus of endogenous sdhb-1 locus. Animals are slow growing with reduced brood size. Insertion verified by PCR. Left flanking sequence: 5' AACTGATGATGTAGCCGCCAAG 3' ; Right flanking sequence: 5' CAGTGAAAGTGCGTGTAGGA 3'. sgRNA: 5' ATCTCTCCGATGGCCTTAGC 3'.
NK2751 T19D12.6(qy149[T19D12.6::mNG + LoxP]) II. C. elegans mNG tag inserted into the endogenous T19D12.6 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2752 qyIs555. C. elegans qyIs555 [cdh-3p::aman-2::GFP]. Anchor cell specific expression of golgi protein aman-2. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2756 qyIs562. C. elegans qyIs562 [zmp-1p::zmp-1sp::sfGFP::KDEL]. Anchor cell specific expression of KDEL ER lumen marker. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2764 adm-4(qy153[adm-4::mNG + LoxP]) X. C. elegans mNG tag inserted into the endogenous adm-4 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2765 qySi120[eef-1A.1p::iATPSnFR1.0::unc-54 3'UTR] I. C. elegans Superfically wild-type strain with ubiquitous somatic expression of ATP biosensor iATPSnFR1.0 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal iATPSnFR1.0 reverse primer: 5' CTTCATCTCGGCGACGGAGAGACGGTT 3'
NK2777 nuo-1(qy157[nuo-1::mKate2]) II. C. elegans mKate2 tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'.
NK2779 fdgt-1(tm3165) II; qyIs553. C.elegans qyIs553 [lin-29p::ceGreenGlifon4000 +unc-119(+)]. fdgt-1(tm3165) null mutant strain expressing green glucose biosensor in the anchor cell. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2780 qySi564 I. C. elegans qySi564 [lin-29p::pfk-1.1::mNG +loxP] I. Single-copy insertion. Anchor cell-specific expression of the mNG-tagged glycolytic enzyme PFK-1.1 forms localized puncta at the site of invasion. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2781 qySi565 I. C. elegans qySi565 [lin-29p::pyk-1a::mNG + loxP] I. Single-copy insertion. Anchor cell-specific expression of the mNG-tagged glycolytic enzyme PYK-1A forms puncta at the site of invasion. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2782 qySi566 I. C.elegans qySi566 [lin-29p::enol-1a::mNG + loxP] I. Single-copy insertion. Anchor cell specific expression of glycolytic enzyme enol-1a which forms puncta at the invasive side and is also expressed in the nucleus. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2783 qySi567 I. C. elegans qySi567 [ced-10p::pyk-1a::mNG + loxP] I. Single-copy insertion. Glycolytic enzyme pyk-1a expressed under the ced-10 promoter which shows uterine expression and forms clusters only in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2784 trak-1(qy158[trak-1::mNG + loxP]) I. C. elegans trak-1 locus endogenously tagged with mNG at the C-terminus. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2785 qySi569 I; fdgt-1(tm3165) II. C.elegans qySi569 [cdh-3p::fdgt-2::mNG + loxP] I. fdgt-1 glucose transporter null mutant expressing a single copy insertion of the glucose transporter fgt-2 in the anchor cell. fdgt-1 and fdgt-2 formerly known as fgt-1 and fgt-2, respectively. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2789 bmdSi15 I; shy61(sec-61.B::GFP11x2) IV. C. elegans bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). 2x split GFP tag (GFP11) inserted into the C-terminus of the endogenous sec-61.B locus.
NK2790 qySi121 I. C. elegans qySi121 [eef-1A.1p::GFP] I. MosSCI insertion.
NK2794 fdgt-1(qy65[fdgt-1::mNG + loxP]) II; unc-6(ev400) X. C.elegans mNG tag inserted into the endogenous fdgt-1 locus. Unc. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2799 unc-119(ed4) III; qyIs570 X. C. elegans qyIs570 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)] X. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP.
NK2800 tct-1(qy161[tct-1::mNG]) I. C. elegans mNG tag inserted into the C-terminus of the endogenous tct-1 locus.
NK2811 F25H2.6(qy162[F25H2.6::mNG + LoxP]) I. C. elegans mNG tag inserted into the endogenous F25H2.6 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2827 snb-1(qy164[snb-1::mNG]) V. C. elegans mNG tag inserted into the C-terminus of the endogenous snb-1 locus.
NK2840 mev-1(qy169[mev-1::mNG]) III. C. elegans mNeonGreen tag inserted into C-terminus of endogenous mev-1 locus. Animals are slow growing with reduced brood size. Insertion verified by PCR. Left flanking sequence: 5' TATCCAGACAAACCATAGGACT 3' ; Right flanking sequence: 5' GCCGAACGAGATTAGACCTAT 3'. sgRNA: 5' CAAGAGCAACAAGACTGCCT 3'.
NK2841 nduf-7(qy170[nduf-7::mNG]) I. C. elegans mNeonGreen tag inserted into C-terminus of endogenous nduf-7 locus. Insertion verified by PCR. Left flanking sequence: 5' GCCGATTTGATTTTCGTTGCCG 3' ; Right flanking sequence: 5' GGCGAATTTGAATGGTCCAGT 3'. sgRNA: 5' GTAAGCGAGAAGCTCAACTT 3'.
NK2844 cox-6A(qy173[cox-6A::mNG]) III. C. elegans mNeonGreen tag inserted into C-terminus of endogenous cox-6A locus. Insertion verified by PCR. Left flanking sequence: 5' AAGGTATCCGACATGAACCGT 3' ; Right flanking sequence: 5' CCATTCAAGCTTTACAGGGTTC 3'. sgRNA: 5' TCAGCCTCGAATCCAACTCC 3'.
NK2845 nduv-2(qy174[nduv-2::mNG]) V. C. elegans mNeonGreen tag inserted into C-terminus of endogenous nduv-2 locus. Insertion verified by PCR. Left flanking sequence: 5' AGATGTCGTTGGCATCGAACGT 3' ; Right flanking sequence: 5' CTTGATCGGTGGTGATAGCTGA 3'. sgRNA: 5' GCTGCTCTTAAATAAACGCT 3'.
NK2864 qySi180 I. C. elegans qySi180 [lin-29p::GFP::CAAX] I. MosSCI single copy insertion. Anchor cell specific expression of CAAX motif. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2902 bmdSi15 I; rpl-31(qy189[rpl-31::ZF1::GFP11]) I; zif-1(gk117) III; qyIs463. C. elegans qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3' UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3' UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus. L4-specific expression of ZIF-1, ubiquitous GFPbeta1-10 and endogenous rpl-31 tagged with ZF-1+GFP-beta11
NK2920 emb-9(qy83[emb-9::mRuby2 + LoxP]) III; gon-1(qy45[gon-1::mNG+loxP]) IV. C. elegans CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus and mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2922 lin-35(n745) I; gon-1(qy45[gon-1::mNG+loxP]) IV. C. elegans CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2925 sms-1(qy198[sms-1::mNG]) IV. C. elegans sms-1 locus endogenously tagged with mNG at the C-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2929 fnta-1(qy199[fnta-1::mNG]) IV. C. elegans fnta-1 locus endogenously tagged with mNG at the C-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2935 hmgr-1(qy202[mNG::hmgr-1]) III. C. elegans hmgr-1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2936 unc-6(cp190[unc-6::mNG::3xFLAG + LoxP]) X. C. elegans mNG and 3xFlag tags inserted into the endogenous unc-6 locus. Superficially wild-type. Reference: Naegeli KM, et al. Dev Cell. 2017 Nov 20;43(4):403-417.e10. doi: 10.1016/j.devcel.2017.10.024. PMID: 29161591
NK2943 hmgr-1(qy202[mNG::hmgr-1]) III; unc-6(ev400) X. C. elegans hmgr-1 locus endogenously tagged with mNG at the N-terminus in unc-6 mutant background. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2949 qySi205 I. C. elegans qySi205 [lin-29p::icmt-1::mscarlet] I. MosSCI single copy insertion. Anchor cell specific expression of prenylation enzyme icmt-1. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2959 rrf-3(pk1426) II; sms-1(qy198[sms-1::mNG]) IV. C. elegans Maintain at 20C or lower. sms-1 locus endogenously tagged with mNG at the C-terminus in rrf-3 mutant background. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2961 rf-3(pk1426) II; qyIs550. C. elegans qyIs550 [zmp-1p::MLS::GFP].
NK2962 rrf-3(pk1426) II; zmp-1(qy17[zmp-1::mNG::GPI]) III. C. elegans mNG and GPI tags inserted into the C-terminus of the endogenous zmp-1 locus.
NK2964 nifk-1(qy126[nifk-1::mNG]) zmp-1(cg115) III. C. elegans mNG tag inserted into the C-terminus of the endogenous nifk-1 locus.
NK2966 qySi205 I; unc-6(ev400) X. C. elegans qySi205 [lin-29p::icmt-1::mScarlet] I. unc-6 mutant expressing anchor cell specific prenylation enzyme icmt-1. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2984 let-2(qy216[let-2::mRuby2]) X. C. elegans mRuby2 tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK2987 let-60(qy220[mNG::let-60 + LoxP]) IV. C. elegans CRISPR/Cas9 insertion of mNeonGreen tag into endogenous let-60 locus. Fairly high penetrance of L1 rod-like lethality. Reference: Jayadev et al. 2023. Post-embryonic endogenous expression and localization of LET-60/Ras in C. elegans. microPublication Biology. 10.17912/micropub.biology.000931.
NK2990 qySi205; qyIs562. C. elegans qySi205 [lin-29p::icmt-1::mscarlet] I. qyIs562 [zmp-1p::zmp-1sp::sfGFP::KDEL]. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and anchor cell specific expression of KDEL ER lumen marker. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2998 rrf-3(pk1426) II; qyIs570. C. elegans qyIs570 [lin-29p::EMTB::GFP].
NK3017 fce-1(qy215[mNG::fce-1]) I. C. elegans fce-1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK3018 mtx-1(qy217[mtx-1::mNG]) I. C. elegans mNeonGreen tag inserted into C-terminus of endogenous mtx-1 locus. Insertion verified by PCR. Left flanking sequence: 5' ATGGAATTACACATTTGGCCG 3' ; Right flanking sequence: 5' TGTTGAGGATCTTTCTTCCT 3'. sgRNA: 5' GACTGACACTTGAATCAGACA 3'.
NK3019 qySi218[rpl-28p::tomm-20::mKate2::3xHA::unc-54 3'UTR] I. C. elegans Superfically wild-type strain with ubiquitous expression of red mitochondria outermembrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
NK3026 let-2(qy228[let-2::mNG]) X. C. elegans mNG tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3027 qySi148 I; lam-2(qy20[lam-2::mNG]) IV. C. elegans qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. mNeonGreen tag inserted into C-terminus of endogenous lam-2 locus. Superfically wild-type strain with AC-specific plasma membrane marker and BM marker. BM visualized with endogenously tagged laminin. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
NK3030 qySi229 I. C. elegans qySi229 [cdh-3p::lmp-1::mNG] I. MosSCI single copy insertion. Anchor cell specific expression of lysosomal protein lmp-1. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK3047 immt-1(qy230[immt-1::mNG]) X C. elegans mNeonGreen tag inserted into C-terminus of endogenous immt-1 locus. Insertion verified by PCR. Left flanking sequence: 5' GTCAATCCAGAAGACGAGTT 3' ; Right flanking sequence: 5' ATCGATGAGAACGGAGGAAC 3'. sgRNA: 5' CTAATAAGTTGAGCGAATCG 3'.
NK3055 qySi147 I; sec-16A.1(qy234[mNG::sec16A.1]) III. C. elegans qySi147 [lin-29p::mKate2::PLC(delta)PH] I. qy234 [mNG::sec16A.1] III. sec16A.1 locus endogenously tagged with mNG at the N-terminus and MosSCI single copy insertion for anchor cell specific expression of membrane marker PLCδPH. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK3057 emb-9(qy236[emb-9::mNG]) III. C. elegans mNG tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3065 qySi205 I; sec-16A.1(qy234[mNG::sec16A.1]) III. C. elegans qySi205 [lin-29p::icmt-1::mscarlet] I. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and sec-16A.1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK3066 rrf-3(pk1426) II; qyIs221. C. elegans qyIs221 [cdh-3p::GFP::ced-10]. Maintain at 20C or lower. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK3072 emb-9(qy244[emb-9::mRuby2]) III. C. elegans mRuby2 tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3073 emb-9(qy245[emb-9::mEos2]) III. C. elegans Photoconvertible mEos2 tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3080 cpIs91 II; sbp-1(qy94[mNG::sbp-1]) III. C. elegans cpIs91 [lag-2p::2x mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR LoxN] II. sbp-1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK3084 mtx-2(qy248[mNG::mtx-2]) III. C. elegans mNeonGreen tag inserted into N-terminus of endogenous mtx-2 locus. Insertion verified by PCR. Left flanking sequence: 5' CTACAATTTGCCTGCCGATGA 3' ; Right flanking sequence: 5' TACCTCGACAGTGGTAAGAA 3'. sgRNA: 5' GACCAATTGGGTTATCACCC 3'.
NK3085 cpIs91 II; immt-1(qy230[immt-1::mNG]) X. C. elegans cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II.  mNeonGreen tag inserted into C-terminus of endogenous immt-1 locus. lag-2 driven red plasma membrane marker.
NK3086 cpIs91 II; ucr-2.1(qy92[ucr-2.1::mNG]) X. C. elegans cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II.  mNeonGreen tag inserted into C-terminus of endogenous ucr-2.1 locus. lag-2 driven red plasma membrane marker.
NK3087 cpIs91 II; nduv-2(qy174[nduv-2::mNG]) V. C. elegans cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II.  mNeonGreen tag inserted into C-terminus of endogenous nduv-2 locus. lag-2 driven red plasma membrane marker.
NK3114 crls-1(qy255[crls-1::mNG]) III. C. elegans mNeonGreen tag inserted into C-terminus of endogenous crls-1 locus. Insertion verified by PCR. Left flanking sequence: 5' AGTCACTACCACCGGAAGAACG 3' ; Right flanking sequence: 5' CTTGGTTTCGGCACTGGTGTTTC 3'. sgRNA: 5' CGGGACTACAGTATGCCAGTAA 3'.
NK3189 qySi275 I. C. elegans qySi275 [nduv-2p::mNG::P2A::mKate2::unc-54 3'UTR] I. nduv-2 transcriptional reporter fused to mNeonGreen and mKate2. Inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type.
NK3210 nuo-1(qy145[nuo-1::mNG]) II; emb-9(qy244[emb-9::mRuby2]) III. C. elegans mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. mRuby2 tag inserted into C-terminus of endogenous emb-9 locus.
NK3211 nuo-1(qy145[nuo-1::mNG]) II; emb-9(qy244[emb-9::mRuby2]) III; unc-6(ev400) X. C. elegans mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. mRuby2 tag inserted into C-terminus of endogenous emb-9 locus. Unc-6 netrin mutation causes reduced movement and protruding vulva (Pvl) phenotype.
NK3212 cox-4(qy134[cox-4::mNG]) I. C. elegans mNeonGreen tag inserted into C-terminus of endogenous cox-4 locus. Insertion verified by PCR. Left flanking sequence: 5' CACGAAGAGAGAACGGTTTTTGA 3' ; Right flanking sequence: 5' TCGACTGGAAACTCTCGAAGGT 3'. sgRNA: 5' TTCTCGTAATCGTAGTGTGT 3'. Superficially wild-type.
NK3229 unc-119(ed4) III; qyIs629. C. elegans qyIs629 [eef-1A.1p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Ubiquitous somatic expression of ratiometric ATP:ADP biosensor PercevalHR.
NK3234 cpIs91 II; crls-1(qy255[crls-1::mNG]) III. C. elegans cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II.  mNeonGreen tag inserted into C-terminus of endogenous crls-1 locus. lag-2 driven red plasma membrane marker.
NK3236 qySi252 [let-2p::mNG] I. C. elegans qySi252 [let-2p::mNG] I. Single-copy CRISPR-based integration into ttTi4348. Wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3237 let-2(qy286[let-2::P2A::PEST::mNG]) X. C. elegans Endogenous reporter of type IV collagen alpha chain (let-2) translation. mNG tag inserted at the endogenous C-terminus locus with a P2A sequence between the C-terminus of let-2 and mNG. P2A causes let-2 to be translated independently of mNG. Cytosolic mNG is a reporter of translation. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3238 emb-9(qy287[emb-9::P2A::PEST::mNG]) III. C. elegans Endogenous reporter of type IV collagen alpha chain (emb-9) translation. mNG tag inserted at the endogenous C-terminus locus with a P2A sequence between the C-terminus of emb-9 and mNG. P2A causes emb-9 to be translated independently of mNG. Cytosolic mNG is a reporter of translation. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3240 emb-9(qy288[emb-9 (G1173D)::mNG]) III. C. elegans Endogenously tagged temperature sensitive glycine substitution mutant allele (b117) of emb-9. Tagged with mNG at the C-terminus. Temperature sensitive. Semi-dominant. Egg lethal. Not maternal. Will grow at 20C. See also CGC DH117. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3241 let-2(qy289[let-2 (G1287D)::mNG]) X. C. elegans Endogenously tagged temperature sensitive glycine substitution mutant allele (b246) of let-2. Tagged with mNG at the C-terminus. Temperature sensitive embryonic lethal. Grows at 15C, 20C. Lethal at 25C (embryonic). See also CGC DH246. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3242 let-2(qy290[let-2::mMaple]) X. C. elegans Photoconvertible mMaple tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3255 mtx-2(qy248[mNG::mtx-2]) III; unc-6(ev400) X. C. elegans mNeonGreen tag inserted into N-terminus of endogenous mtx-2 locus in netrin null mutant background (ev400).
NK3271 qySi296 I. C. elegans qySi296 [eef-1A.1p::SL2::HYlight::tbb-2 3'UTR] I. Ubiquitous somatic expression of glycolysis ratiometric biosensor HYlight inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
NK3281 unc-119(ed4) III; unc-6(ev400) X; qyIs552. C. elegans qyIs552 [lin-29p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of ratiometric ATP:ADP biosensor PercevalHR. netrin null mutant background (ev400).
NK3299 qySi312 I. C. elegans qySi312 [eef-1A.1p::SL2::HYlight-RA::tbb-2 3'UTR] I. Ubiquitous somatic expression of glycolysis ratiometric biosensor Hylight-reduced affinity (RA) control inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
NK3304 qySi313 I; unc-119(ed4) III; qyIs629. C. elegans qySi313 [lin-29p::ucp-4::SL2::mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR] I. qyIs629 [eef-1A.1p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Ubiquitous somatic expression of ratiometric ATP:ADP biosensor PercevalHR. Anchor cell specific overexpression of mitochondrial uncoupling protein, UCP-4, (expression confirmed by presence of red anchor cell membrane). qySi313 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
NK3306 unc-119(ed4) III; unc-6(ev400) X; qyIs636. C. elegans qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP in netrin null mutant background (ev400).
NK3314 qySi148 I; unc-119(ed4) III; qyIs636. C. elegans qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
NK3325 qySi316 I. C. elegans qySi316 [nuo-1p::mNG::P2A::mKate2::unc-54 3'UTR] I. Transcriptional nuo-1 reporter fused to mNeonGreen and mKate2 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type.
NK358 unc-119(ed4) III; qyIs43. C. elegans qyIs43 [pat-3::GFP + ina-1(genomic) + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: Hagedorn et al., Dev Cell (2009) Aug 17(2):187-98.
NK364 unc-119(ed3) III; qyIs46. C. elegans qyIs46 [emb-9p::emb-9::mCherry + unc-119(+)] X. Superficially wild-type with very low penetrance (~5%) rupture. Integrated collagen::mCherry reporter. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
NK413 rrf-3(pk1426) II; qyIs50 V. C. elegans qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V.
NK564 unc-119(ed4) III; qyEx78. C. elegans qyEx78 [Venus::unc-6(deltaSP) + unc-119(+)]. Maintain by picking non-Unc.
NK640 rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs102. C. elegans qyIs102 [fos-1ap::rde-1(genomic) + myo-2::YFP + unc-119(+)]. Uterine-specific RNAi.
NK651 unc-119(ed4) III; qyIs108. C. elegans qyIs108 [lam-1p::lam-1::Dendra + unc-119(+)]. High expression in basement membranes; cleaner laminin-dendra expression than NK652. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
NK652 unc-119(ed4) III; qyIs109. C. elegans qyIs109 [lam-1p::lam-1::Dendra + unc-119(+)]. High expression in basement membranes, also accumulates in body wall muscle. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
NK696 unc-119(ed4) III; qyIs127. C. elegans qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
NK741 rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs138. C. elegans qyIs138 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion.
NK742 rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs139. C. elegans qyIs139 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion.
NK772 unc-119(ed4) III; qyEx115. C. elegans qyEx115 [C11D9.1::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK773 unc-119(ed4) III; qyEx114. C. elegans qyEx114 [C28C12.10::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK774 unc-119(ed4) III; qyEx116. C. elegans qyEx116 [C14A11.3b::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK775 unc-119(ed4) III; qyEx117. C. elegans qyEx117 [C14A11.3a,c::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK776 unc-119(ed4) III; qyEx118. C. elegans qyEx118 [exc-5::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK777 unc-119(ed4) III; qyEx121. C. elegans qyEx121 [F55C7.7d::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK778 unc-119(ed4) III; qyEx120. C. elegans qyEx120 [F55C7.7c::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK779 unc-119(ed4) III; qyEx119. C. elegans qyEx119 [F13E6.6::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK780 unc-119(ed4) III; qyEx122. C. elegans qyEx122 [F55C7.7e::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK781 unc-119(ed4) III; qyEx123. C. elegans qyEx123 [K07D4.7a::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK782 unc-119(ed4) III; qyEx124. C. elegans qyEx124 [pix-1::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK783 unc-119(ed4) III; qyEx125. C. elegans qyEx125 [R02F2.2::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK784 unc-119(ed4) III; qyEx126. C. elegans qyEx126 [T19E10.1::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK785 unc-119(ed4) III; qyEx127. C. elegans qyEx127 [ced-5::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK786 unc-119(ed4) III; qyEx128. C. elegans qyEx128 [F22G12.5::GFP + unc-119(+)]. Maintain by picking non-Unc.
NK860 unc-119(ed4) III; qyIs161. C. elegans qyIs161 [emb-9p::emb-9::Dendra + unc-119(+)]. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
NK885 unc-119(ed4) III; qyIs174. C. elegans qyIs174 [hlh-2p::GFP::hlh-2 + unc-119(+)]. Translational fusion protein displaying cytoplasmic and nuclear localization; contains 8 kb upstream, N-terminal GFP fusion, full open reading frame and 3'UTR. Reference: Schindler AJ, Sherwood DR. Dev Biol. 2011 Sep 15;357(2):380-91.
NK887 unc-119(ed4) III; qyIs176. C. elegans qyIs176 [zmp-1(50-51)p::mCherry::moeABD + unc-119(+)]. Reference: Schindler AJ, Sherwood DR. Dev Biol. 2011 Sep 15;357(2):380-91.
PS4865 unc-119(ed4) III; him-5(e1490) V; syEx684. C. elegans syEx684 [unc-119(+) + fos-1a/b::GFP-TL]. Ex line of functional fos-1 gene tagged with GFP at the C-terminus. Pick WT to maintain. Throws males. Do not distribute this strain; other labs should request it from the CGC.
RIE102 unc-119(ed3) III; ftt-2(tm1486) X; atrIs1. C. elegans atrIs1 [ftt-2p::ftt-2::mCherry + unc-119(+)]. Line is slightly sick and burrows. FTT-2::mCherry fusion protein rescues ftt-2(tm1486) deletion mutant. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284. PMID: 28648843
SBW292 ebp-2(wow47[ebp-2::GFP::3xFLAG]) II. C. elegans GFP and 3xFlag tags inserted into the C-terminus of the endogenous ebp-2 locus.
This laboratory hasn't submitted any alleles to the CGC.