| AH1747 |
C. elegans |
unc-119(ed3) III; zhIs35 I. Show Description
zhIs35 [let-23::GFP + unc-119(+)] I. zhIs35 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene expression is higher in this strain than in AH1779 unc-119(ed3) III; zhIs38. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341.
|
|
| AH1779 |
C. elegans |
unc-119(ed3) III; zhIs38 IV. Show Description
zhIs38 [let-23::GFP + unc-119(+)] IV. zhIs38 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene is expressed at levels similar to endogenous LET-23. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341.
|
|
| PS1411 |
C. elegans |
let-23(sy1) II; sli-1(sy143) X. Show Description
sli-1 is a silent suppressor of the Vul phenotypes of let-23(lf) mutants. sy1;sy143 animals are Hyperinduced. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS21 |
C. elegans |
let-23(sy1) II; him-5(e1490) V. Show Description
Viable allele of let-23. Vul. Throws males. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS632 |
C. elegans |
unc-101(sy161) I; let-23(sy1) II. Show Description
Grows slowly with low brood numbers. Sluggish worms.
|
|
| PS79 |
C. elegans |
dpy-10(e128) let-23(sy1) II. Show Description
Dumpy. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS80 |
C. elegans |
let-23(sy1) unc-4(e120) II. Show Description
Unc. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC.
|
|
| AML597 |
C. elegans |
lgc-47(sy1501) X; wtfIs46. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML614 |
C. elegans |
lgc-47(sy1501) X; wtfIs46; wtfEx535. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx535 [tdc-1p::AI::lgc-
47::SL2::his-24::tagRFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in RIML/R neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML617 |
C. elegans |
lgc-47(sy1501) X; wtfIs46; wtfEx538. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx538 [npr-9p::AI::lgc-47::SL2::tagBFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML618 |
C. elegans |
lgc-47(sy1501) X; wtfIs46; wtfEx539. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx539 [rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AVA neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML622 |
C. elegans |
lgc-47(sy1501) X; wtfIs46; wtfEx543. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx543 [tdc-1p::AI::lgc-47::SL2::his-24::tagRFP + npr-9p::AI::lgc-47::SL2::tagBFP + rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB, AVA,
and RIM neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML659 |
C. elegans |
acc-1(tm3268) IV; lgc-47(sy1501) X; wtfIs46. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. mec-4 promoter drives expression of activating opsin molecule Chrimson and fluorescent protein mCherry in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. (2024) iScience. https://www.sciencedirect.com/science/article/pii/S2589004224020017 PMID: 38585821.
|
|
| BC11520 |
C. elegans |
dpy-5(e907) I; sIs10358. Show Description
sIs10358 [rCesY102A11A.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC11566 |
C. elegans |
dpy-5(e907) I; sEx11566. Show Description
sEx11566 [rCesY19D10A.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC11990 |
C. elegans |
dpy-5(e907) I; sEx11990. Show Description
sEx11990 [rCesY106G6E.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12786 |
C. elegans |
dpy-5(e907) I; sIs11990. Show Description
sIs11990 [rCesY106G6E.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12927 |
C. elegans |
dpy-5(e907) I; sIs12803. Show Description
sIs12803 [rCesY18D10A.6a::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC13336 |
C. elegans |
dpy-5(e907) I; sIs13113. Show Description
sIs13113 [rCesY110A7A.20::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC13672 |
C. elegans |
dpy-5(e907) I; sEx13672. Show Description
sEx13672 [rCesY105E8A.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC13865 |
C. elegans |
dpy-5(e907) I; sEx13865. Show Description
sEx13865 [rCesY17G9B.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC14121 |
C. elegans |
dpy-5(e907) I; sEx14121. Show Description
sEx14121[rCesY116A8C.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC14395 |
C. elegans |
dpy-5(e907) I; sEx14395. Show Description
sEx14395 [rCesY17G7B.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC14685 |
C. elegans |
dpy-5(e907) I; sEx14685. Show Description
sEx14685 [rCesY110A7A.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC15005 |
C. elegans |
dpy-5(e907) I; sEx15005. Show Description
sEx15005 [rCesY111B2A.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC15356 |
C. elegans |
dpy-5(e907) I; sEx15356. Show Description
sEx15356 [rCesY110A2AL.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16336 |
C. elegans |
dpy-5(e907) I; sEx16336. Show Description
sEx16336 [rCesY116A8C.35::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| MH351 |
C. elegans |
let-60(sy101sy127)/dpy-20(e1282) IV. Show Description
Heterozygotes are WT and segregate WT, Dpys and lethals.
|
|
| PS1009 |
C. elegans |
unc-101(sy237) I; sli-1(sy143) X. Show Description
|
|
| PS1258 |
C. elegans |
sli-1(sy129) X. Show Description
Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS1410 |
C. elegans |
let-23(sy15) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS1423 |
C. elegans |
let-23(sy17) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Reference null allele for let-23. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2286 |
C. elegans |
unc-38(x20) lfe-2(sy326) I. Show Description
Fertile Unc-38. sy326 has no phenotype on its own. Suppresses sterility of let-23(sy10) and lin-3(n1058). Sterile in double mutant combination with lfe-1 alleles. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2366 |
C. elegans |
itr-1(sy328) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2368 |
C. elegans |
itr-1(sy327) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2512 |
C. elegans |
itr-1(sy331) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2516 |
C. elegans |
itr-1(sy291) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2582 |
C. elegans |
itr-1(sy290) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2728 |
C. elegans |
sli-1(sy143) X. Show Description
Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS302 |
C. elegans |
let-23(sy10) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. sy10 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS468 |
C. elegans |
let-60(sy100) dpy-20(e1282)/let-60(n1046) unc-22(s7) IV; him-5(e1490) V. Show Description
Heterozygotes are weak Muv and segregate weak Muv, Muv Twitchers, and Dpy Vuls whose progeny are larval lethal. sy100 is a dominant negative allele of let-60. n1046 is a gain-of-function allele of let-60. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS5131 |
C. elegans |
let-23(sy12)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are GFP+. mIn1 homozygotes are Dpy and GFP+. let-23(sy12) homozygotes are non-GFP.
|
|
| PS524 |
C. elegans |
let-60(sy100) dpy-20(e1282) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are non-Dpy Vul and segregate non-Dpy Vul, DpyVul whose progeny are dead, and dead eggs. sy100 is dominant Vul and recessive Lethal with maternal rescue: homozygotes from heterozygous mothers grow to adulthood and become a bag of dead larvae. sy100 is not 100% penetrant. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS529 |
C. elegans |
unc-101(sy108) I. Show Description
Unc. Suppresses the Vul phenotypes of let-23(lf) mutants. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS611 |
C. elegans |
mab-21(sy155) III; him-5(e1490) V. Show Description
Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Body is slightly shorter. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS746 |
C. elegans |
let-23(sy97) II; sli-1(sy143) X. Show Description
sy143 suppresses sy97 viability from 15% to 100%, P12 -> P11 transformations from 27% to 14% and Vul from 100% to 3%. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS7731 |
C. elegans |
K03E5.2(sy1082) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT;
right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGG
Reference: Wang H, et al. G3 (Bethesda).
|
|
| PS7734 |
C. elegans |
T05C3.2(sy1080) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAA
Right flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGC
inserted sequence between the two flanking sequence (STOP-In casette):
GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS7778 |
C. elegans |
clik-1(sy1084) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6)
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG;
right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda).
|
|
| PS7783 |
C. elegans |
K03E5.2(sy1086) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: aaaattttcagAAGCTGGCCTCAAAATTGCCGCCG
Right flanking sequence: TCTCGAGGTGCCAAGCAATGAACAATTGGAGAGGAG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTGCTTGGCACCTCGACGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
