Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
DCL569 C. elegans mkcSi13 II; rde-1(mkc36) V. Show Description
mkcSi13 [sun-1p::rde-1::sun-1 3'UTR + unc-119(+)] II. Germline rescue of the rde-1(mkc36) indel mutation, allowing germline-specific RNAi. Reference: Zou L, et al. Scientific Reports Volume 9, Article number: 2354 (2019) "Construction of a germline-specific RNAi tool in C. elegans."
IG1839 C. elegans frSi17 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454
IG1846 C. elegans frSi21 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454
WM27 C. elegans rde-1(ne219) V. Show Description
RNAi deficient.
WM45 C. elegans rde-1(ne300) V. Show Description
RNAi deficient. Reference: Tabara H, et al. Cell 1999 Oct 15:99(2):123-32.
JU2039 C. elegans mfIs70 IV; rde-1(ne219) V. Show Description
mfIs70 [lin-31p::rde-1 + myo2p::GFP]. mfIs70 is a spontaneous integration in LG IV. Superficially wild-type. This strain can be used for Pn.p-specific RNAi. Reference: Barkoulas et al. (2013) Developmental Cell Jan 14;24(1):64-75
QK52 C. elegans rde-1(ne219) V; xkIs99. Show Description
xkIs99 [wrt-2p::rde-1::unc-54 3'UTR]. NOTE: This strain was originally published as JM43 in Melo JA, Ruvkun G. Reference: Melo JA, Ruvkun G. Cell. 2012 Apr 13;149(2):452-66.
SD1989 C. elegans rde-1(ne300) V; gaIs290. Show Description
gaIs290 [elt-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. RNAi-resistant. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Recombineered fosmid was integrated by biolistic bombardment. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Mann F, et al. PLoS. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
WM118 C. elegans rde-1(ne300) V; neIs9 X. Show Description
neIs9 [myo-3::HA::rde-1 + rol-6(su1006)] X. Transgene rescues muscle RNAi defect. Rollers.
AMJ345 C. elegans jamSi2 II; rde-1(ne219) V. Show Description
jamSi2 [mex-5p::rde-1(+)] II. mex-5p::rde-1(+) inserted into ttTi5605 on LG II. Tissue-specific RNAi rescue allows silencing in germline and intestine. Reference: Marre JA, et al. Proc Natl Acad Sci USA. 2016.
JK4143 C. elegans qIs57 II; rde-1(ne219) V; qIs140. Show Description
qIs57 [lag-2p::GFP] II. qIs140 [lag-2p::rde-1 + rol-6(su1006)]. Rollers. qIs140 rescues rde-1 in lag-2-expressing cells (as tested by GFP RNAi). qIs57 GFP expression in DTCs. Do not distribute this strain; other labs should request it directly from the CGC.
NR221 C. elegans rde-1(ne219) V; kzIs8. Show Description
kzIs8 [lin-26p::NLS::GFP + rol-6(su1006)]. Maintain by picking Rollers.
NR350 C. elegans rde-1(ne219) V; kzIs20. Show Description
kzIs20 [hlh-1p::rde-1 + sur-5p::NLS::GFP]. Muscle specific RNAi. kzIs20 genotype differs from published data; this information is correct per Hiroshi Qadota.
SD1954 C. elegans rde-1(ne219) V; kzIs9; wgIs600. Show Description
kzIs9 [(pKK1260) lin-26p::NLS::GFP + (pKK1253) lin-26p::rde-1 + rol-6(su1006)]. Rollers. Hypodermis specific RNAi. wgIs600 [unc-62::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering.
VP303 C. elegans rde-1(ne219) V; kbIs7. Show Description
kbIs7 [nhx-2p::rde-1 + rol-6(su1006)]. Rollers. RNAi effective only in intestine. Maintain under normal conditions. Reference: Espelt MV, et al., J Gen Physiol. 2005 Oct;126(4):379-92.
WM28 C. elegans unc-32(e189) III; rde-1(ne219) V. Show Description
RNAi deficient. Unc.
JU2058 C. elegans rrf-3(pk1426) II; mfIs70 IV; rde-1(ne219) V. Show Description
mfIs70 [lin-31p::rde-1 + myo2p::GFP]. mfIs70 is a spontaneous integration in LG IV. Superficially wild-type. This strain can be used for Pn.p-specific RNAi. Reference: Barkoulas et al. (2013) Developmental Cell Jan 14;24(1):64-75
NK2115 C. elegans cpIs121 I; rrf-3(pk1426) II; rde-1(ne219) V. Show Description
cpIs121 [lag-2p::mNG::PH::F2A::rde-1] I. Temperature-sensitive: maintain at 16-20C. RNAi-response variant. RNAi-hypersensitized DTC-specific RNAi strain that labels all rde-1(+) cells with mNeonGreen. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284.
NR222 C. elegans rde-1(ne219) V; kzIs9. Show Description
kzIs9 [(pKK1260) lin-26p::NLS::GFP + (pKK1253) lin-26p::rde-1 + rol-6(su1006)]. Rollers. Hypodermis specific RNAi.
RA382 C. elegans rdIs7 I; unc-119(ed3) III; rde-1(ne219) V. Show Description
rdIs7 [hnd-1::rde-1 + unc-119(+)] I. Rescued for RNAi in the mesoderm and SGPs. Reference: Large EE and Mathies LD. G3 (Bethesda). 2014 Mar 20;4(3):471-83.
SD1963 C. elegans unc-119(ed3) III; rde-1(ne300) V; gaEx234. Show Description
gaEx234 [elt-2p::elt-2::GFP + unc-119(+)]. Pick non-Unc to maintain. Long-lived. Overexpression of ELT-2. RNAi-resistant. Reference: Mann F, et al. PLoS.
SD1965 C. elegans unc-119(ed3) III; rde-1(ne300) V; gaEx233. Show Description
gaEx233 [unc-119(+)]. Pick non-Unc to maintain. Reference: Mann F, et al. PLoS.
TU3135 C. elegans mec-8(u218) I; rde-1(ne219) V; uIs46. Show Description
uIs46 [rde-1p::mec-2(intron9)::rde-1) + ceh-22::GFP]. Temperature sensitive; maintain at 15 C. RNAi-sensitive at 15 C. Mechanosensory abnormal at 25 C. Uses the ninth intron of mec-2, whose splicing depends on mec-8, to produce temperature-sensitive expression and temperature-sensitive RNAi. Reference: Calixto et al. (2010) Nature Methods 7:407-11.
BB23 C. elegans adr-1(gv6) I; adr-2(gv42) III; rde-1(ne219) V. Show Description
RNAi deficient. Maintain under normal conditions. Reference: Tonkin LA & BassBL. Science. 2003 Dec 5;302(5651):1725. Knight SW & Bass BL. Mol Cell. 2002 Oct;10(4):809-17.
BB242 C. elegans adr-1(uu49) I; adr-2(uu28) III; rde-1(uu51) V. Show Description
RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
NK640 C. elegans rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs102. Show Description
qyIs102 [fos-1ap::rde-1(genomic) + myo-2::YFP + unc-119(+)]. Uterine-specific RNAi.
NK741 C. elegans rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs138. Show Description
qyIs138 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion.
NK742 C. elegans rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs139. Show Description
qyIs139 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion.
XE1057 C. elegans eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
BB270 C. elegans adr-1(uu49) I; rrf-3(uu56) II; adr-2(uu28) III; rde-1(uu51) V. Show Description
RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
XE1474 C. elegans wpSi6 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi6 [dat-1p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Dopaminergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the dopaminergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1581 C. elegans wpSi10 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi10 [unc-17p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Cholinergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the cholinergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1582 C. elegans wpSi11 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi11 [eat-4p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Glutamatergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the glutamatergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1375 C. elegans wpIs36 I; wpSi1 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpIs36 [unc-47p::mCherry] I. wpSi1 [unc-47p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. GABAergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the GABAergic neurons; all other tissues are resistant to RNAi. Superficially wild type with mCherry fluorescence in the GABA motor neurons. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
ANR153 C. elegans rde-1(ne300) V.; neIs9 X; pkIs2386. Show Description
pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. neIs9 [myo-3::HA::rde-1 + rol-6(su1006)] X. Rollers. YFP expression in the muscles. Derived by crossing parental strains NL5901 and WM118 to produce a Parkinson's model with muscle-only RNAi. Reference: Snow S, et al. (2024). Neuronal CBP-1 is required for enhanced body muscle proteostasis in response to reduced translation downstream of mTOR. Frontiers in Bioscience-Landmark.
BFF48 C. elegans mjIs134 II; hrde-1(tm1200) III. Show Description
mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Maintain at 15C. Heritable RNAi deficient, Mortal germline (Mrt) at 25C. Expressing nuclear GFP in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614
BFF49 C. elegans mjIs134 II; hrde-1(tm1200) III; meg-3(tm4259);meg-4(ax2026) X. Show Description
mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Maintain at 15C. Heritable RNAi deficient, germ granule defective, high sterility. Expresses nuclear GFP in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614
BFF68 C. elegans mjIs134 II; hrde-1(pig6[AID*::HA::hrde-1]) III. Show Description
mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. N-terminal Auxin-Inducible AID-1* and HA tag inserted into the endogenous hrde-1 locus. GFP fluorescence in germline (mex-5::gfp). Control strain for BFF69; does not carry TIR1 transgene necessary for the degradation. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.
BFF69 C. elegans mjIs134 II; hrde-1(pig6[AID*::HA::hrde-1]) III; ieSi38 IV. Show Description
mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. N-terminal Auxin-Inducible AID* and HA tag inserted into the endogenous hrde-1 locus. Germline-expressed TIR1 and germline GFP. Allows for the degradation of hrde-1 and heritable RNAi deficiency in the presence of auxin. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.
CYA13 C. elegans frSi17 II; rde-1(ne300) V; ldrIs1. Show Description
frSi17 [mtl- 2p::rde-1 3'UTR] II. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. Derived by crossing parental strains IG1839 and LIU1. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. frSi17 inserted into ttTi5605 site.
CYA14 C. elegans rde-1(ne300) V; neIs9 X; ldrIs1. Show Description
neIs9 [myo-3p::HA::rde-1 + rol-6(su1006)] X. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. Rollers. RDE-1 activity is rescued in the body-wall muscle, making animals RNAi-deficient except for body-wall muscle cells. Derived by crossing parental strains WM118 and LIU1. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets.
GS9801 C. elegans rde-1(ar660) V. Show Description
rde-1(ar660)[rde-1(lox2272-flexon-lox2272)]. 9th intron of rde-1 replaced with a flexon - an artificial exon flanked by artificial introns that each contain a lox2272 site (a flexon). Severely reduces rde-1 function, function can be restored upon excision of the flexon by Cre recombinase. Reference: Shaffer JM & Greenwald I. Proc Natl Acad Sci U S A. 2022 Jan 18;119(3):e2117451119. doi: 10.1073/pnas.2117451119. PMID: 35027456.
JMC217 C. elegans rde-1(tor153[GFP::3xFLAG::rde-1]) V. Show Description
GFP and 3xFLAG tags inserted into endgonenous rde-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC231 C. elegans hrde-1(tor125[GFP::3xFLAG::hrde-1]) III. Show Description
GFP and 3xFLAG tags inserted into endgonenous hrde-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
SX2499 C. elegans prde-1(mj207) V. Show Description
piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
SX2500 C. elegans prde-1(mj258) V. Show Description
piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
SX2650 C. elegans mjSi74 I. Show Description
mjSi74 [mex-5p::wormCherry::prde-1::par-5] I. Integration into ttTi4348. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
SX3073 C. elegans mjIs588 II; unc-119(ed3) III Show Description
mjIs588 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. mjIs588 was derived by removing introns 2 and 3 from the construct used to generate the mjIs144 transgene. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type. mjIs588 GFP is silenced in wild-type animals and de-silenced in hrde-1 mutant animals. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6.
TAM201 C.elegans rde-1(ram40) V. Show Description
RNAi-defective. rde-1(ram40) is an engineered full length deletion (start codon to stop codon) in the endogenous rde-1 locus. Reference: Knittel TL, et al. Nat Commun. 2025 Jul 1;16(1):5595. doi: 10.1038/s41467-025-60721-5. PMID: 40595566.
WM191 C. elegans sago-2(tm894) ppw-1(tm914) ppw-2(tm1120) wago-2(tm2686) wago-1(tm1414) I; wago-11(tm1127) wago-5(tm1113) wago-4(tm1019) II; hrde-1(tm1200) sago-1(tm1195) III; wago-10(tm1186) V; nrde-3(tm1116) X. Show Description
Maintain at 15 C. MAGO12 mutant. RNAi resistant. Temperature sensitive. Reference: Gu, et al. 2009 Mol Cell 36:234-44.