| AMP100 |
C. elegans |
ieSi57 II; rpb-2(cer135[rpb-2::GFP(delta)piRNA::AID*::3xFLAG]) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. cer135 is a rpb-2::GFP(delta)piRNA::AID*::3xFLAG tag inserted into the endogenous rpb-2 locus. This strain allows auxin-dependent disruption of RNA polymerase II with dose-dependent lifespan shortening. Reference: Oswal N, et al. PLoS Comput Biol. 2022 Sep 30;18(9):e1010415. PMID: 36178967.
|
|
| AMP101 |
C. elegans |
weSi174 II; daf-2(syb1177[daf-2::AID*::TEV::3xFLAG]) III. Show Description
weSi174 [eif-3.Bp::TIR1::linker::mCherry(dpiRNA)::tbb-2 3'UTR + unc-119(+)] II. Auxin-inducible degradation of DAF-2::AID* causes dauer formation. Reference: Eder M, et al. Cell. 2024 Jul 25;187(15):3919-3935.e19. doi: 10.1016/j.cell.2024.05.050. PMID: 38908368.
|
|
| AMP116 |
C. elegans |
weSi174 II; daf-2(syb1177[daf-2::AID*::TEV::3xFLAG]) glp-1(e2141) III. Show Description
weSi174 [eif-3.Bp::TIR1::linker::mCherry(dpiRNA)::tbb-2 3'UTR + unc-119(+)] II. Maintain at 20C or less. Sterile at 25C. Auxin-inducible degradation of DAF-2::AID* causes dauer formation. Reference: Eder M, et al. Cell. 2024 Jul 25;187(15):3919-3935.e19. doi: 10.1016/j.cell.2024.05.050. PMID: 38908368.
|
|
| AUM1880 |
C. elegans |
prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I; plk-3(viz172[plk-3 delta 21u-10935] viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
|
|
| HCL67 |
C. elegans |
unc-119(ed3) III; uocIs1. Show Description
uocIs1 [eft-3p::Cas9(dpiRNA)::tbb-2 3' UTR + unc-119(+)]. Cas9 is optimized to remove all piRNA sites. Cas9 is expressed in the germline. Reference: Zhang D, et al. Science. 2018 Feb 2;359(6375):587-592.
|
|
| JDW460 |
C. elegans |
noah-1(wrd119[noah-1::linker::mNeonGreen(dpiRNA)::3xFLAG(internal)::linker]) I. Show Description
Internal mNeonGreen(dpiRNA)::3xFLAG tags with linker sequences inserted into endogenous noah-1 locus. mNeonGreen(dpiRNA) is optimized to remove all piRNA sites. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.
|
|
| SX1287 |
C. elegans |
mjIs145 II; unc-119(ed3) III. Show Description
mjIs145 [mex-5p::GFP::his-58::21UR-1sense::tbb-2 3'UTR] II. Control piRNA sensor strain accompanying SX1316. Instead of antisense 21UR-1 target site, this transgene contains the piRNA sequence in sense and histone GFP is not silenced. Reference: Bagijn MP, et al. Science. 2012 Aug 3;337(6094):574-8.
|
|
| SX1316 |
C. elegans |
mjIs144 II; unc-119(ed3) III. Show Description
mjIs144 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. piRNA sensor strain. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type with loss of piRNA sensor silencing in piRNA pathway mutants (e.g. prg-1). GFP is silenced in wild-type, expressed in piRNA pathway mutants and can be used as a simple read-out for piRNA pathway function. Reference: Bagijn MP, et al. Science. 2012 Aug 3;337(6094):574-8.
|
|
| SX2499 |
C. elegans |
prde-1(mj207) V. Show Description
piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
|
|
| SX2500 |
C. elegans |
prde-1(mj258) V. Show Description
piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
|
|
| WHY8 |
C. briggsae |
Cbr-prg-1(how21) I. Show Description
C. briggsae strain. Reduced fecundity at 20°C and 25°C. Generated by CRISPR/Cas9 in AF16 background, prg-1(how21) is a 5 bp deletion located 47 bp downstream of the start codon that causes frameshift. prg-1(how21) is presumed null; consistent with previous findings that the stability of piRNAs and Piwi protein are co-dependent in C. elegans, the overall abundance of 21 U-RNAs in Cbr-prg-1(how21) was reduced to ~1% of wild-type. Reference: Pastore B, et al. RNA Biol. 2022 Jan;19(1):1276-1292. doi: 10.1080/15476286.2022.2149170.
|
|
