Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
FAS46 C. elegans his-72 (uge30[gfp::his-72]) III. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FX2066 C. elegans his-72(tm2066) III. Show Description
Homozygous viable and fertile. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
DV3285 C. elegans his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
FAS43 C. elegans his-69&his-70(uge44) his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X. Show Description
Deletion of all genes coding H3.3 histone variant. Superficially wild-type with slight reduction of brood size at 25C. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
RW10006 C. elegans unc-119(ed3) ruIs32 III; zuIs178 V. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. Ubiquitous histone-GFP fusion protein in embryo and adult germline as well as many adult somatic cells.
AML344 C. elegans juSi164 unc-119(ed3) III; wtfIs263. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs263 [rab-3p::AI::ChR2(H134R)::unc-54 3'UTR + rab-3p::AI::Voltron::unc-54 3'UTR + rab-3p::his-24::tagBFP::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of ChR2 (H134R) along with Voltron volatage indicator and nuclear-localized tagBFP. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML376 C. elegans juSi164 unc-119(ed3) III; wtfEx296. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx296 [rab-3p::AI::gur-3G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Pick RFP+ to maintain. Keep plates covered to avoid unnecessary exposure to light. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML405 C. elegans juSi164 unc-119(ed3) III; wtfEx315. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx315 [5xQUAS::(delta)pes-10P::AI::gur-3G::unc-54 3'UTR + 5xQUAS::(delta)pes-10P::AI::prdx-2G::unc-54 3'UTR + rab-3p::AI::QF+hGR::unc-54 3'UTR + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML438 C. elegans juSi164 unc-119(ed3) III; wtfIs335. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs335 [5xQUAS+(delta)pes-10p::AI::eTsChR::unc-54 3'UTR + rab-3p::AI::QF+hGR::SL2::tagBFP::unc-54 3'UTR + rab-3p::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal eTsChR on activation using dex treatment via QF+hGR. Worms also express calcium sensing fluorescence protein- GCaMP6s in nuclei of each neurons. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML470 C. elegans juSi164 unc-119(ed3) III; wtfIs458. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs458 [mec-4::Chrimson4.2::SL2::mCherry::unc-54 3' UTR + unc-122::GFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Transgenic animals express light-gated ion channel Chrimson and a fluorescent protein mCherry in mechanosensory neurons alongside GFP in coelomocytes. Reference: Liu M, et al. PLoS Biol. 2022 Jan 28;20(1):e3001524. doi: 10.1371/journal.pbio.3001524. PMID: 35089912.
AML540 C. elegans juSi164 unc-119(ed3) III; wtfIs483. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs483 [rab-3p::AI::lite-1G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of a purple/violet light-sensitive optogenetic protein system LITE-1 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
CZ20310 C. elegans juSi164 unc-119(ed3) III. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. Maintain in the covered box to avoid unnecessary exposure to ambient light. Wild-type behavior in movement, mating, growth and brood size. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Wild-type behavior in movement, mating, growth and brood size. MosSCI insertion into oxTi444 on Chr. III. Reference: Noma K & Jin Y. Nature Communications, 2015.
DV3651 C. elegans his-72(erb77[his-72::linker::mTurquoise2]) III; yap-1(re269[yap-1::mNeonGreen::2xFLAG]) X. Show Description
mTurqoise2 tag with linker sequence inserted into endogenous his-72 locus. mNeonGreen::2xFLAG tag inserted into endogenous yap-1 locus. Ubiquitous yellow fluorescence (488 nm or 514 nm) is cytosolic with modest nuclear signal and strong exclusion from nucleoli, but translocates to nuclei upon disruption of upstream Hippo pathway components. Deficiency of cst-1/2 (Hippo/MST) causes translocation into nuclei of all hypodermal cells, deficiency of wts-1 (Warts/LATS) causes translocation into nuclei of all cell types observed. YAP-1::mNG::2xFLAG may be non-functional, as endogenous tag blocks lethality conferred by deficiency of WTS-1. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657. Sloan DE & Bembenek JN. MicroPubl Biol. 2021 Sep 29:2021:10.17912/micropub.biology.000471. PMID: 34604717.
DV4186 C. elegans his-72(erb77[his-72::linker::mTurquoise2]) III; yap-1(re269[yap-1::mNeonGreen::2xFLAG]) reDf4 X. Show Description
Mild uncharacterized Unc. reDf4 is a deletion of the tandemly duplicated cst-1 and cst-2 loci as well as intervening ncRNAs. Ubiquitous yellow fluorescence (488 nm or 514 nm) is cytosolic with modest nuclear signal and strong exclusion from nucleoli, but translocates to nuclei upon disruption of upstream Hippo pathway components. Deficiency of cst-1/2 (Hippo/MST) causes translocation into nuclei of all hypodermal cells. YAP-1::mNG::2xFLAG may be non-functional, as endogenous tag blocks lethality conferred by deficiency of WTS-1. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657. Sloan DE & Bembenek JN. MicroPubl Biol. 2021 Sep 29:2021:10.17912/micropub.biology.000471. PMID: 34604717.
DZ841 C. elegans tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III; zuIs236. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.
GLW27 C. elegans muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26
JJ1850 C. elegans unc-119(ed3) III; zuIs178. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. HIS-72::GFP can be detected in germline and most somatic nuclei, but not in intestinal nuclei. Not integrated on X.
JJ1851 C. elegans unc-119(ed3) III; zuEx181. Show Description
zuEx181[his-72(1kb 5' UTR)::YFP::GSRPVAT::HIS-72::HIS-72 (1KB 3'UTR) + 5.7 kb XbaI - HindIII UNC-119(+)]. HIS-72::YFP signal can be detected in the germline and most somatic nuclei, but not in intestinal nuclei.
JJ2059 C. elegans unc-119(ed3) III; zuIs235. Show Description
zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
JJ2060 C. elegans unc-119(ed3) III; zuIs236. Show Description
zuIs236 [his-72(1-kb 5' UTR)::BIRA::GFP:: his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
JJ2061 C. elegans unc-119(ed3) III; zuIs235; zuIs236. Show Description
zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. zuIs236 [his-72(1-kb 5' UTR)::BIRA::GFP:: his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
JJ2281 C. elegans unc-119(ed3) III; zuIs258. Show Description
zuIs258 [his-72p::his-72(5' UTR)::BIRA::GFP::his-72(3' UTR) + unc-119(+)]. GFP expression detectable in embryos. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
JJ2300 C. elegans unc-119(ed3) III; zuIs258; zuIs263. Show Description
zuIs258 [his-72p::his-72(5' UTR)::BIRA::GFP::his-72(3' UTR) + unc-119(+)]. GFP expression detectable in embryos. zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
OD1854 C. elegans ltSi539 II; ltSi507 IV; nre-1(hd20) lin-15B(hd126) X; stIs10389. Show Description
ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570.
RW10007 C. elegans pha-1(e2123) stIs10007 III; zuIs178 V. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10007 [pha-4 (4.1kb)) H3::H3::GFP::H3 3'UTR + pie-1p::H2B::GFP::pie-1 3'UTR + pha-4p::H1::DsRed::T1::let-858 3'UTR]. May still contain ruIs32 [pie-1::H2B-GFP + unc-119(+)] in the background.
RW10026 C. elegans unc-119(ed3) III; stIs10026. Show Description
stIs10026 [his-72::GFP::his-72 3' UTR full length translation fusion + unc-119(+)].
RW10029 C. elegans zuIs178; stIs10024. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. May still have unc-119(ed3) in the background.
RW10048 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10044. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10044 [mir-57::HIS-24::mCherry + unc-119(+)].
RW10060 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10060. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10060 [cnd-1(3.2kb)::HIS-24::mCherry + unc-119(+)].
RW10062 C. elegans unc-119(ed3) III; zuIs178 V; stIs10050. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10050 [pha-4(4kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
RW10064 C. elegans unc-119(ed3) III; zuIs178 V; stIs10064. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10064 [end-3::H1-wCherry::let-858 3' UTR + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
RW10083 C. elegans unc-119(ed3) III; zuIs178 V; stIs10059. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10059 [cnd-1(3.2kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
RW10084 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10039. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10039 [mir-61::H1.1-GFP::let-858 3' UTR + unc-119(+)].
RW10097 C. elegans unc-119(ed3) III; zuIs178 V; stIs10088. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10088 [hlh-1(3.3kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
RW10098 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10035. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10035 [eft-3-L2::H1-wCherry + unc-119(+)].
RW10108 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10086. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10086 [ges-1::H1-wCherry + unc-119(+)].
RW10112 C. elegans unc-119(ed3) III; stIs10026; stIs10089. Show Description
stIs10026 [his-72(1kb)::HIS-72::GFP + unc-119(+)]. stIs10089 [hlh-1(3.3kb)::HIS-24::mCherry + unc-119(+)].
RW10131 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10131. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10131 [elt-7::H1-wCherry + unc-119(+)].
RW10166 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10157. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10157 [dpy-7::H1-wCherry + unc-119(+)].
RW10174 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10174. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10174 [pal-1::H1-wCherry + unc-119(+)].
RW10175 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10138. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10138 [tbx-38::H1-wCherry + unc-119(+)].
RW10177 C. elegans unc-119(ed3) III; zuIs178; stIs10177. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10177 [cwn-1::H1-wCherry::his-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
RW10196 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10122. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10122 [hnd-1::MycCherry I (modENCODE39) + unc-119(+)].
RW10197 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10137. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10137 [med-2::H1-wCherry + unc-119(+)].
RW10199 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10140. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10140 [vab-7::H1-wCherry + unc-119(+)].
RW10206 C. elegans unc-119(ed3) III; zuIs178; stIs10308. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10308 [die-1::H1-wCherry::let-858 3'UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
RW10230 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10224. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10224 [lin-39::H1-wCherry + unc-119(+)].
RW10234 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10220. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10220 [end-1::H1-wCherry + unc-119(+)].
RW10238 C. elegans unc-119(ed3) III; zuIs178; stIs10190. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10190 [C08B11.3::H1-wCherry::let-858 3'UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
RW10249 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10218. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10218 [tbx-11::H1-wCherry + unc-119(+)].