| BC1519 |
C. elegans |
dpy-18(e364)/eT1 III; sDf31/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. Original isolation: BO strain BC1261 unc-22(s727) hermaphrodite heat shocked for 1 hour at 34C. Crossed to N2 strain BC1270 unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Picked individual WT hermaphrodites. Screened for the absence of gravid Unc-22. Retained strain as BC1379. Balanced over eT1: BC1379 unc-22(s727)[BO]/nT1[N2] IV; sDf31[BO]/nT1[N2] hermaphrodite crossed to BC 1265 dpy-18(e364)/eT1 III; unc-46(e177)/eT1 V. Pick WT hermaphrodites that twitch in 1% nicotine. Retained one strain that segregated Unc-36 as BC1428. Pseudolinked sDf31 to dpy-18: BC1428 +/eT1 III; sDf31[BO]/eT1 V crossed to BC 1265 dpy-18/eT1 III; unc-46/eT1 V male. Picked WT hermaphrodite F1. From strains segregating Unc-36 but no Dpy or Unc-46 or DpyUnc-46, cross WT hermaphrodites to BC1265 males. From strains producing Dpy, crossed individual WT males to BC70 eT1;eT1. From each cross, crossed WT X WT. Kept one strain producing on Dpy or DpyUncs as S-H716 male. Picked one hermaphrodite to start BC1519. Comments: 1) The LGV region balanced by eT1 should be all BO. 2) Probably the rest of the genome still has a considerable amount from BO since it was crossed to N2 only 4 times. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
| KR1355 |
C. elegans |
let-114(h716) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early/mid larval development.
|
|
| OH7160 |
C. elegans |
vtIs1 V; ets-5(tm866) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
|
|
| OH7169 |
C. elegans |
C50A2.4(tm440) IV; vtIs1 V. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
|
|
| VH7162 |
C. elegans |
F47D12.7(hd7162[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 3115 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAGTGGACGGTTTTGTGGGCATAATGCAT; Right flanking sequence: CCACTCCCCTTTTTCGGAAATTGGAAAACG. sgRNA #1: CACATTTCACGCACAGAAGA; sgRNA #2: TGAACGAAAGATTAACGGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7163 |
C. elegans |
+/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ ula-1(hd7157 [loxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + loxP]) III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7157 and CGC66. hd7157 is a 1439 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AATTTGATAATCTCTTGAGCAGCTATTCCA; Right flanking sequence: GTTGGTGGCTGACTACTTGCACTACCAGAG. sgRNA #1: CCGACGTACGATGAAATGAC; sgRNA #2: CATCTTCCATAGCTAACGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7165 |
C. elegans |
ps-25&sf1=all">mrps-25 (hd7151 [loxP + myo-2p::GFP::unc-54 3’ UTR + ps-2&sf1=all">rps-2 7p::neoR::unc-54 3’ UTR + loxP])/tmC25 [unc-5(tm9708)] IV. Show Description
Apparent homozygous lethal or sterile deletion balanced with tmC25. Maintain by picking wild-type GFP+. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7151 and FX30257. hd7151 is a deletion of 435 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCCGATAAAGTTGTGACGCCCTTTGCCA; Right flanking sequence: TGTCGATCTTCCTTGTTTTTTGTTGAAAAA. sgRNA #1: AAACTTACTCAGATATGCTC; sgRNA #2: CAAAAACTAGCTAGAAATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7166 |
C. elegans |
ncap-1(hd7160[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAGGCCTCCAGTAGATGCTCCAGGAGCCG; Right flanking sequence: CGGGATGCGATACACGAAAACCTTGGGTTT. sgRNA #1: TGCAGTTTCCCGCCCTCGTC; sgRNA #2: TGACCGCTGGTTCCGATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7167 |
C. elegans |
gsto-3(hd7161[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 3555 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAACTGTGGATAGAATTAGGGGTGGACGAA; Right flanking sequence: AATATAGTATTATAGGACCGAAAATATAGA. sgRNA #1: AAACGATTTACTCCGGCTAT; sgRNA #2: CAAAAAATTAGCGTCTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7168 |
C. elegans |
F56B3.6(hd7168[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAACTTCTGGACAACCGGCAGAAACGCCA; Right flanking sequence: GTAGGCACAAAGAAGGCGTAGGCCTCCTGG. sgRNA #1: TGGCGTTTCAGAGCTGCACG; sgRNA #2: AAAGCCAATTGTCTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7169 |
C. elegans |
mdh-1(hd7169[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 969 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAGACCTTGAACAATCTTCCATTCGCCA; Right flanking sequence: CGGACATTCTGAAAATTTAGCAATTTACAC. sgRNA #1: TTCCCAGTTACCATCGAGGG; sgRNA #2: GACCAAAACGCGAAGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|