Search Strains

3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-1 locus. sgRNA #1: TATTGCGGCCCGCCGGACAT; sgRNA #2: TCAAACGACCCAATGTCCGG. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.

eaIs4 [him-5p::him-5::GFP::3xFLAG::him-5 3'UTR + unc-119(+)]. Transgene recapitulates published HIM-5 expression patterns and can rescue high incidence of males phenotype of him-5 mutants. Reference: McClendon TB. et al. G3 (Bethesda). 2016 Dec 7;6(12):3913-3925. PMID 27678523.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.

stIs10312 [lim-7::TY1::EGFP::3xFLAG + unc-119(+)].

stIs10316 [die-1::TY1::EGFP::3xFLAG + unc-119(+)].

stIs10325 [mes-4::TY1::EGFP::3xFLAG + unc-119(+)].

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10318 [nhr-25::TGF(3H4)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10311 [lin-39::TGF(3D3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10309 [mab-5::TY1::eGFP::3xFLAG(P000007_E01)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

gaIs269 [nhr-23::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in fosmid P000006_G11.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10394 [cnd-1::TGF(3C3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

st10455 [elt-7::TY1::EGFP::3xFLAG + unc-119(+)].

stIs10470 [tbx-8::TY1::EGFP::3xFLAG + unc-119(+)].

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10426 [med-2::TGF(6.2B3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10436 [hlh-1::TGF(6.2B4)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10472 [lin-11::TGF(7H3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10470 [tbx-8::TGF(7G2)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10452 [lin-13::TGF(6.2B12)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

st10563 [glp-1::TY1::EGFP::3xFLAG + unc-119(+)].

stIs10702 [hlh-6::TY1::EGFP::3xFLAG + unc-119(+)].

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10485 [ttx-3::TGF(8G1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10453 [elt-2::TGF(7E1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10525 [ceh-14::TGF(8F2)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10757 [alr-1::TGF(10A2)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10867 [egl-5::TGF(7E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs80 [eor-1::TGF(9G1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs87 [ceh-6::TGF(9H1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10703 [ceh-26::TGF(10B1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs108 [fkh-4::TGF(11D3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs94 [pal-1::TY1::eGFP::3xFLAG(P000006_G02)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs76 [unc-130::TY1::eGFP::3xFLAG(P000007_E01)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

dxbp-1(st12180[dxbp-1::TY1::EGFP::3xFLAG]) I.

egl-43(st12181[egl-43::TY1::EGFP::3xFLAG]) II.

atg-4.1(st12185[atg-4.1::TY1::EGFP::3xFLAG]) I.

tbx-38(st12186[tbx-38::TY1::EGFP::3xFLAG]) III.

swsn-1(st12187[swsn-1::TY1::EGFP::3xFLAG]) V.

nfyb-1(st12190[nfyb-1::TY1::EGFP::3xFLAG]) II.

arid-1(st12194[arid-1::TY1::EGFP::3xFLAG]) V.

egrh-3(st12196[egrh-3::TY1::EGFP::3xFLAG]) IV.

bed-1(st12201[bed-1::TY1::EGFP::3xFLAG]) V.

ekl-4(st12207[ekl-4::TY1::EGFP::3xFLAG]) I.

grh-1(st12208[grh-1::TY1::EGFP::3xFLAG]) I.

CRISPR/Cas9 engineered tagged endogenous locus.

ceh-20(st12211[ceh-20::TY1::EGFP::3xFLAG]) III.

lin-1(st12212[lin-1::TY1::EGFP::3xFLAG]) IV.

php-3(st12213[php-3::TY1::EGFP::3xFLAG]) III.

CRISPR/Cas9 engineered tagged endogenous locus.

CRISPR/Cas9 engineered tagged endogenous locus.

CRISPR/Cas9 engineered tagged endogenous locus.