Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
QK67 C. elegans alg-1(xk5[3xFLAG::alg-1]) X. Show Description
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-1 locus. sgRNA #1: TATTGCGGCCCGCCGGACAT; sgRNA #2: TCAAACGACCCAATGTCCGG. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.
QP1961 C. elegans eaIs4. Show Description
eaIs4 [him-5p::him-5::GFP::3xFLAG::him-5 3'UTR + unc-119(+)]. Transgene recapitulates published HIM-5 expression patterns and can rescue high incidence of males phenotype of him-5 mutants. Reference: McClendon TB. et al. G3 (Bethesda). 2016 Dec 7;6(12):3913-3925. PMID 27678523.
RAF2181 C. elegans ieSi57 II; daf-2(bch-40[AID*::3xFLAG::STOP::SL2::SV40::AID*::wrmScarlet::egl-13NLS]) unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.
RW10312 C. elegans unc-119(tm4063) III; stIs10312. Show Description
stIs10312 [lim-7::TY1::EGFP::3xFLAG + unc-119(+)].
RW10316 C. elegans unc-119(ed3) III; stIs10316. Show Description
stIs10316 [die-1::TY1::EGFP::3xFLAG + unc-119(+)].
RW10325 C. elegans unc-119(ed3) III; stIs10325. Show Description
stIs10325 [mes-4::TY1::EGFP::3xFLAG + unc-119(+)].
RW10348 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10318. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10318 [nhr-25::TGF(3H4)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10349 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10311. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10311 [lin-39::TGF(3D3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10350 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10309. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10309 [mab-5::TY1::eGFP::3xFLAG(P000007_E01)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10425 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10389. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10429 C. elegans unc-119(ed3) III; gaIs269. Show Description
gaIs269 [nhr-23::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in fosmid P000006_G11.
RW10434 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10394. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10394 [cnd-1::TGF(3C3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10455 C. elegans unc-119(ed3) III; stIs10455. Show Description
st10455 [elt-7::TY1::EGFP::3xFLAG + unc-119(+)].
RW10470 C. elegans unc-119(ed3) III; stIs10470. Show Description
stIs10470 [tbx-8::TY1::EGFP::3xFLAG + unc-119(+)].
RW10479 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10426. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10426 [med-2::TGF(6.2B3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10481 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10436. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10436 [hlh-1::TGF(6.2B4)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10493 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10472. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10472 [lin-11::TGF(7H3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10558 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10470. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10470 [tbx-8::TGF(7G2)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10560 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10452. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10452 [lin-13::TGF(6.2B12)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10563 C. elegans unc-119(ed3) III; stIs10563. Show Description
st10563 [glp-1::TY1::EGFP::3xFLAG + unc-119(+)].
RW10702 C. elegans unc-119(ed3) III; stIs10702. Show Description
stIs10702 [hlh-6::TY1::EGFP::3xFLAG + unc-119(+)].
RW10713 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10485. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10485 [ttx-3::TGF(8G1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10714 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10453. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10453 [elt-2::TGF(7E1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10726 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10525. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10525 [ceh-14::TGF(8F2)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10757 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10757. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10757 [alr-1::TGF(10A2)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10867 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10867. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10867 [egl-5::TGF(7E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10868 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs80. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs80 [eor-1::TGF(9G1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10871 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs87. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs87 [ceh-6::TGF(9H1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10913 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10703. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10703 [ceh-26::TGF(10B1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10914 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs108. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs108 [fkh-4::TGF(11D3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10993 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs94. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs94 [pal-1::TY1::eGFP::3xFLAG(P000006_G02)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW11144 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs76. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs76 [unc-130::TY1::eGFP::3xFLAG(P000007_E01)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW12180 C. elegans dxbp-1(st12180[dxbp-1::TY1::EGFP::3xFLAG]) I. Show Description
dxbp-1(st12180[dxbp-1::TY1::EGFP::3xFLAG]) I.
RW12181 C. elegans egl-43(st12181[egl-43::TY1::EGFP::3xFLAG]) II. Show Description
egl-43(st12181[egl-43::TY1::EGFP::3xFLAG]) II.
RW12185 C. elegans atg-4.1(st12185[atg-4.1::TY1::EGFP::3xFLAG]) I. Show Description
atg-4.1(st12185[atg-4.1::TY1::EGFP::3xFLAG]) I.
RW12186 C. elegans tbx-38(st12186[tbx-38::TY1::EGFP::3xFLAG]) III. Show Description
tbx-38(st12186[tbx-38::TY1::EGFP::3xFLAG]) III.
RW12187 C. elegans swsn-1(st12187[swsn-1::TY1::EGFP::3xFLAG]) V. Show Description
swsn-1(st12187[swsn-1::TY1::EGFP::3xFLAG]) V.
RW12190 C. elegans nfyb-1(st12190[nfyb-1::TY1::EGFP::3xFLAG]) II. Show Description
nfyb-1(st12190[nfyb-1::TY1::EGFP::3xFLAG]) II.
RW12194 C. elegans arid-1(st12194[arid-1::TY1::EGFP::3xFLAG]) V. Show Description
arid-1(st12194[arid-1::TY1::EGFP::3xFLAG]) V.
RW12196 C. elegans egrh-3(st12196[egrh-3::TY1::EGFP::3xFLAG]) IV. Show Description
egrh-3(st12196[egrh-3::TY1::EGFP::3xFLAG]) IV.
RW12201 C. elegans bed-1(st12201[bed-1::TY1::EGFP::3xFLAG]) V. Show Description
bed-1(st12201[bed-1::TY1::EGFP::3xFLAG]) V.
RW12207 C. elegans ekl-4(st12207[ekl-4::TY1::EGFP::3xFLAG]) I. Show Description
ekl-4(st12207[ekl-4::TY1::EGFP::3xFLAG]) I.
RW12208 C. elegans grh-1(st12208[grh-1::TY1::EGFP::3xFLAG]) I. Show Description
grh-1(st12208[grh-1::TY1::EGFP::3xFLAG]) I.
RW12210 C. elegans hmg-1.2(st12210[hmg-1.2::TY1::EGFP::3xFLAG]) III. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
RW12211 C. elegans ceh-20(st12211[ceh-20::TY1::EGFP::3xFLAG]) III. Show Description
ceh-20(st12211[ceh-20::TY1::EGFP::3xFLAG]) III.
RW12212 C. elegans lin-1(st12212[lin-1::TY1::EGFP::3xFLAG]) IV. Show Description
lin-1(st12212[lin-1::TY1::EGFP::3xFLAG]) IV.
RW12213 C. elegans php-3(st12213[php-3::TY1::EGFP::3xFLAG]) III. Show Description
php-3(st12213[php-3::TY1::EGFP::3xFLAG]) III.
RW12215 C. elegans mcd-1(st12215[mcd-1::TY1::EGFP::3xFLAG]) II. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
RW12220 C. elegans pha-4(st12220[pha-4::TY1::EGFP::3xFLAG]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
RW12221 C. elegans nhr-41(st12221[nhr-41::TY1::EGFP::3xFLAG]) IV. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.