Search Strains

F54D5.3. External left primer: TTGGCTTTGCAGGAGCTAAT. External right primer: CAAAATGCAGCGAAAAACAA. Internal left primer: CACCGATGACACTGGTCACT. Internal right primer: CAATTTGGCCGGAGATTTTA. Internal WT amplicon: 1165 bp. Deletion size: 455 bp. Deletion left flank: CTATTTAATAAGCTTCGTTACCAACTTCTG. Deletion right flank: CAAGGTTCGAATTGGATTTTTTTTAACTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3176) in T26A8.4, detectable by PCR using the following primers. External left primer: TGCTTTGGCTCTTCTTGGAT. External right primer: TGTTTGCGCTGAGAGAGAGA. Internal left primer: GCTGAACTAATCCAGGCTGC. Internal right primer: TCCAACGTTCAAGATTCCAA. Internal WT amplicon: 1977 bp. Deletion size: approximately 625 bp. Validation: gk3176 passed by CGH. Left deleted probe: TTGCGGTGGCTGAACTAATCCAGGCTGCTGAAGATGTGGATGTTGAATTG. Right deleted probe: AAACTAACCTTTTTACAAAAACTATTAGCATAAAAGTTGCACAGAACAGG. Other deletions (gk3219, gk3220) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0250.4. External left primer: CCTGACGGGATGTGCTTAAT. External right primer: AACCAATGAATCCAACGGAA. Internal left primer: ACCAGTTTGGTGCGAAATGT. Internal right primer: AAATCCACGGAACCATTGAA. Internal WT amplicon: 2200 bp. Deletion size: 384 bp. Deletion left flank: AACACATTTTCTCTTGGCAATAGAAGGTAT. Deletion right flank: TCACATTTTTTATTGATTCAAAAAATTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B12.4. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2848 homozygotes (Dpy hermaphrodite, strongly Him, males more WT. Healthy gravid WT non-GFP segregants are recombinants and not true homozygotes). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCGCATTTGAAAGTATGA. External right primer: AAGCAAAAAGCAATGCAGGT. Internal left primer: GCAGTTGAACATCAGGGAGG. Internal right primer: GGACGCCTACGCACAATACT. Internal WT amplicon: 1145 bp. Deletion size: 396 bp. Deletion left flank: TACTACTTGAAAATGCTTCGTTAAAAATGA. Deletion right flank: GGAACTTCTAACAACAATTATATTCGACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 406 bp. Deletion left flank: CCACTCCAGTTCCATTCCCTCCATCTCCAA. Deletion right flank: GAAATCTGCCGAGAGACTATTCACAATGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06B8.7. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2814 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 680 bp. Deletion left flank: GCTTAAAGCAGGAGAGACCAAAGCGTGCTT. Deletion right flank: TCTCCGAATGATCGTATCACACTGGCCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E02H1.5, E02H1.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2819 homozygotes (late larval arrest or sterile with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGACGTCGGTTTATGCAGC. External right primer: CCATGGTGTGCTCATTTTTG. Internal left primer: CCGGCATTCAAGTCAAATCT. Internal right primer: GGCAAGTTCGCAGATTCTTT. Internal WT amplicon: 2609 bp. Deletion size: 1622 bp. Deletion left flank: ACAATAATTAACCAAATTCCAGACGATAAT. Deletion right flank: CATTTCAGATCGTTTGGACAGTGATGAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T23F11.1. External left primer: GAGACCCACTCGCTAACCAC. External right primer: GCGGGATGAACAATAGAGGA. Internal left primer: CTTCTGTCTCTCGGAAACGC. Internal right primer: CGAAAGGTATTTCAACCGGA. Internal WT amplicon: 3253 bp. Deletion size: 1421 bp. Deletion left flank: GAAAGTTATCAGAGCAAAAATGTGATAAAA. Deletion right flank: CTGACAAGCTGACACCGGATCACGAGTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16B12.5. External left primer: AATTGTACGGCGGAAAACTG. External right primer: ACCACGGTTGCATAGGACTC. Internal left primer: CTTGGCAAGACAAATGATCG. Internal right primer: CTGGACGGGTCAGTTTCAAT. Internal WT amplicon: 2766 bp. Deletion size: 1271 bp. Deletion left flank: GCATTTGGTCTCAATGAAAAAAAGAATCAG. Deletion right flank: TTAATTAGTACCACATTTAGGATGCAAAAA. Insertion Sequence: AAAAAGAAAACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09H9.7. External left primer: TTGTGGAAACGGCTTAGACC. External right primer: AAACATTTCGAATTACGCCG. Internal left primer: GCGGTGAATCAGGAGATGAT. Internal right primer: TTTCAGGAAACCAGCGATTC. Internal WT amplicon: 1078 bp. Deletion size: 246 bp. Deletion left flank: TTCTTCGTCTGCGGTGAATCAGGAGATGAT. Deletion right flank: ACCTTAATATATCAATTAATAAAGGTATAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59D12.1. External left primer: CTCACAAAAAGGGGCGAATA. External right primer: TACCCCTTACACTAACGGCG. Internal left primer: GGTTGTGTTCTATCCCGACG. Internal right primer: ATGAGTGCTTGGGACTTTGG. Internal WT amplicon: 937 bp. Deletion size: 198 bp. Deletion left flank: CTTTAACACAGGCTGGAAAATCTGGTCAGC. Deletion right flank: CCATTTGATATGGATTTATCAATGGTAAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50F4.7. External left primer: GATCCAGAGCTTCTCGCAGT. External right primer: ACAATTCCAGGTGGACAAGC. Internal left primer: TCTTCACCGTCTTTCCGAAC. Internal right primer: ATGGTTGGTAGCCACTGCTT. Internal WT amplicon: 820 bp. Deletion size: 317 bp. Deletion left flank: TCGTTTTCTAACAACTTTTAATCATGTCTG. Deletion right flank: CGATGGACGTTGTCTATGCCTTGAAACGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54G7,4. External left primer: ACAATCGGAAAATTGCCAAG. External right primer: TAGATTACGCGGAGCGAAGT. Internal left primer: TTCCATATCGTGACACAGCG. Internal right primer: CCACGCCCTCAGTAAGGTAA. Internal WT amplicon: 2412 bp. Deletion size: 679 bp. Deletion left flank: TGATTTGCATCAGCGATGAATTGTGCTTTC. Deletion right flank: CACACTCAAAACCTTTCAGTACTTCATTAG. Insertion Sequence: GTGTGACCAAGCTGTTGAATGCTATTTAAGACGGAGCCTGCCACAGAAAGCATTGCACG CGTGTAAAGAGCTGAATCAGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42E11.1. External left primer: TGGACTTGCATGGAACACAT. External right primer: AATCATTTCTTCACGGGCAC. Internal left primer: ACACTACAACTTACCCGCCG. Internal right primer: GGTGGTGTCATCTTTGGCTT. Internal WT amplicon: 2647 bp. Deletion size: 1230 bp. Deletion left flank: ACCACAAAATAATGTTTTCATTTTTAACTT. Deletion right flank: CTTATCCAACTAGACCTGACGTCAAAATTT. Insertion Sequence: TCAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20G5. External left primer: ATCAACCGGAGAACACGAAC. External right primer: AACCTGTTTGAATCGAACGC. Internal left primer: GCAAATGCACTAGATGCGAA. Internal right primer: GATTGGACGTGATGGAGGTT. Internal WT amplicon: 1084 bp. Deletion size: 306 bp. Deletion left flank: AAACCTTCATATCTTCCATTACTAATAGGT. Deletion right flank: TTCGTTCCGCTCTTTTCCGAAAGGGATTTC. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02H7.1. External left primer: TTCAAGGAATGGTACCGGAG. External right primer: GGGCATTTCCAAGTTTTTCA. Internal left primer: GGAAACGCATGAAGAGAAGG. Internal right primer: CCTTGCTAGCGGATAAGCAG. Internal WT amplicon: 1196 bp. Deletion size: 647 bp. Deletion left flank: ACTGTTATATCAAATATGGAAACTGATTTG. Deletion right flank: AAGATTTAGTTGATGAAGAAGATAGAGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53C12C.1. External left primer: GAACTTCGAAAATGGGCAAA. External right primer: TGATGCCGCCATATATTCAA. Internal left primer: ATCAATCAAGAATGCCCACC. Internal right primer: TTCACTCACGGTTTACCACG. Internal WT amplicon: 2128 bp. Deletion size: 1210 bp. Deletion left flank: AAAAAGTTTGAGTAGACTTTAACTGAGTAT. Deletion right flank: TTAATATAATTCAATTAATTCATCAGGTAA. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27B7.6. External left primer: AGAAGGAGCCAAACGTGAGA. External right primer: AGGCAGGTATGAGGTAGGCA. Internal left primer: GTCAATCGAGACACGCAGAA. Internal right primer: GCTAGGAATGAAATAGGCACG. Internal WT amplicon: 3109 bp. Deletion size: 2657 bp. Deletion left flank: CTTCATTCAAAGGAAATCTACGCATTTTCA. Deletion right flank: TTCCTAGCTACATGCCTACCTCATACCTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0303.8, B0303.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2494 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAGCCCTGGAAGACATTGAT. External right primer: AGTGAAACCATTGTCGGAGC. Internal left primer: ACCACCATACGGATCTCCAA. Internal right primer: CGGACTTTTTGGTTTCGATT. Internal WT amplicon: 2348 bp. Deletion size: 1060 bp. Deletion left flank: GAGTTTGGTATCCAGGTGTTGAAGTTTGAA. Deletion right flank: ACTGGGAAGGGACTGTTAGTTTTCTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33H1.4. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk953 homozygotes (arrest stage/phenotype undetermined). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGGCCATTCCTTGAAAGGTT. External right primer: GCTAGTAGTCGCTGATCCCG. Internal left primer: GAGGTACCCGTAGATCGCAA. Internal right primer: CGAAATCCGTTCTCCATCAT. Internal WT amplicon: 2555 bp. Deletion size: 836 bp. Deletion left flank: TTGCTCCAAATGCGGGAATTGAAGATAATA. Deletion right flank: GAAGATCGTATTGGTAGATCTGATTTAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K04G7.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2483 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACCCAAACGTGGCAATA. External right primer: TTGTTAAGACCATCATGCCG. Internal left primer: AAAAGTGTGCGTGGGGTAAT. Internal right primer: GTTCCATGAGCAAATTGGGA. Internal WT amplicon: 3154 bp. Deletion size: 1295 bp. Deletion left flank: TCTATTACTTAAAGCAAATTTTCAAATTGA. Deletion right flank: AGTCTAGAAACAATTATTTTGAAAGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC404.9. External left primer: TAGTCGATCCGCGTACACAA. External right primer: GGACCACTTTCGGAACTTCA. Internal left primer: AGATAGATTTCCATCCGGCA. Internal right primer: AAACTTTGCGTGGCTTGAAT. Internal WT amplicon: 1258 bp. Deletion size: 549 bp. Deletion left flank: TTCTTTCAGAATGATATCCTCGATTCAAAC. Deletion right flank: GTTTTTCAACACAAGCAACTTCCGGAGCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK337.1. External left primer: TCCAGACGTGCTGACAACTC. External right primer: GGCGCTACTCCACCATTAAA. Internal left primer: TCAGCTTTTGGCGATAGTGAT. Internal right primer: GTCTTCCATGGCTGTGAGGT. Internal WT amplicon: 1142 bp. Deletion size: 360 bp. Deletion left flank: TCTCTCTCAATTATTCGTTGGTTAGTATCC. Deletion right flank: AAGTGGGCTTTTTTCAAATTTTTTCAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C03A7.4. External left primer: GAACCGGTTTACTGAGCAGC. External right primer: GTTAGCTTGGCAAGAGCAGG. Internal left primer: TATTGCGTTCCTTGCATGTG. Internal right primer: AGTTGCTGGTTGAGCAGCTT. Internal WT amplicon: 1101 bp. Deletion size: 793 bp. Deletion left flank: CAATCCGTGAAAAGAGACAGTGTGGATGTGCTCAGCCACAGCAGAGCCAATGCTCGTGC CAACAAGTTCAACAGACTCAGTCATGCTCGTGCCAATCTGCTCCAGTTCAACAACAATC CCCATCCTGCTCATGCGCTCAGCCACAACAAACTCAACAAGTTCAGGTACAGTTCATTA ACATATTCGCAAACCATTAAATCAAAAATTTTAG. Deletion right flank: AAACTGCCTGCCAATCATCATGCTCTAACTCA. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C41D11.5. External left primer: ATTCGGCTTTTGAGGGCTAT. External right primer: AGCGGCTCTTCACTGTCAAT. Internal left primer: AATGGATCCAATTGTCGGAA. Internal right primer: TCAAATTAATCGCTCGTCCC. Internal WT amplicon: 1275 bp. Deletion size: 879 bp. Deletion left flank: CACCATTCTGAGCCATTTTCCATCATTTCT. Deletion right flank: AAGACACTTTTAGAGATTTACGGAAGGCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C38C10.1. External left primer: TGGTCATGGTCGAATCCATA. External right primer: ACATTTTCCAATTCTTGCGG. Internal left primer: CTGCAATTGAATCGGAAACA. Internal right primer: TTTTGTTGCTCCGGATTTTC. Internal WT amplicon: 1214 bp. Deletion size: 755 bp. Deletion left flank: TACTATGACTGGTGGTATGGTGATCTATGT. Deletion right flank: ACTATCAAAAAATCAATGAAAATCCGGAGC. Insertion Sequence: GGTGATCTATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07G1.2. External left primer: TCGTGGCAATTGACTGTGAT. External right primer: CGCCGAATATGATGATGATG. Internal left primer: TTTTTGTGAATCTGGAAGAGAATG. Internal right primer: TTACTCACCCAAATCCGAGC. Internal WT amplicon: 1139 bp. Deletion size: 346 bp. Deletion left flank: TTATCCCAATGTTACATTCCACCATGTCCA. Deletion right flank: CTTCTGCTCTAACTAGCTATTTCTATTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38H6C.17. External left primer: CCGGTTGCTTACATGCCTAC. External right primer: GATTCGCCAATCTTCCAAAA. Internal left primer: AAGCAATACGTACCGGTCTACA. Internal right primer: AAAGTTTCCAAATTTTTCGGC. Internal WT amplicon: 1372 bp. Deletion size: 525 bp. Deletion left flank: ATATACCCAAAGAATCCTAGAAATGCATAA. Deletion right flank: CGTTGCCGAAAAATTTGGAAACTTTCTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50F7.10. External left primer: TCCGATCGACAGCTAACCTT. External right primer: AAAGGATCCAGTTTGCCTCA. Internal left primer: TTTCTCTCATTGAGGCTGGG. Internal right primer: TCATTCCGTCGATGTCTTGT. Internal WT amplicon: 1104 bp. Deletion size: 592 bp. Deletion left flank: GCCTGCATGTTTATTTCGTTGAAAGTTATC. Deletion right flank: AAAGACATAACCGAACAAGACATCGACGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3D.5. External left primer: TGGACGGTTGAAAACATTGA. External right primer: ACGCCTAGCTCAAAGCAAAA. Internal left primer: TCGCATCAGCTGTTTGATTC. Internal right primer: CGGTCTCAGCTTCTGAGCTT. Internal WT amplicon: 1633 bp. Deletion size: 818 bp. Deletion left flank: AAATTCAGAATATGCCCAACCGAAACTCAC. Deletion right flank: GTTTTGCAAAACCAGCGTCCATCTATTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07C12.11. External left primer: TAGAACGAAATACGACCGGG. External right primer: TCCTTCCCAGACCATGTAGG. Internal left primer: ACGCTTTCGAGAAGAACTGG. Internal right primer: TCAAGATTTGGGATTCTCGC. Internal WT amplicon: 2378 bp. Deletion size: 1314 bp. Deletion left flank: GATCCTAGAATTGAAAAATTAATATCCACA. Deletion right flank: GCAAAGAAATGTATCATTATTTTTTGAGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12H6.12. External left primer: CTGCGTCTCTCACTTTTCCC. External right primer: CTTCGTTGCAGACACTTGGA. Internal left primer: GGAGGAGAACAATGGCTCAA. Internal right primer: AGCTGAGTAACGGCGATTTG. Internal WT amplicon: 2398 bp. Deletion size: 1573 bp. Deletion left flank: TTTCAATGTACTGAGTGCACATTTGCGAGT. Deletion right flank: TCAATATTTTCCATTGTTCTTGATGCTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20F7.1. External left primer: AAACGACACTCCGTTTGGAC. External right primer: AGTGACCGGAAGCTCTTGAA. Internal left primer: TCCGGGAGAAGTATTCATGG. Internal right primer: CGGTCCTCCACATCTGAAAT. Internal WT amplicon: 2098 bp. Deletion size: 305 bp. Deletion left flank: ATTTTTTAAATGAGTTTGATATAAAAATGA. Deletion right flank: TATGAATCAACAGTATGGTGTGGAAAACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y17G7B.22. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1350 bp. Deletion left flank: AATGGACCTGAAAGATTGAAAACAATTGAC. Deletion right flank: TTTTGGTGCTTCAAAAAACATCAAAAAATA. Insertion Sequence: GTGTGGTAAGCGAAAGTAAGCGAAAATTCAAGCTTCGATTGAATTATCATTTCAAAAAG AAATAAATGGAAAACGTATTGTAATCGCTGAACAAACTCCAAAAAATTTGATACTTTTT GATGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K04F1.15, C54E4.2. The allele gk1083 was identified by PCR, validated by CGH, and can be detected using the following PCR primers. External left primer: TTTTTGACGACCAACCAACA. External right primer: CGAGGCTCTTTACGCAATTC. Internal left primer: CGCAGCGAACAAAGTTATGA. Internal right primer: CGTGGCGAGACCTATAAAGC. Internal WT amplicon: 1288 bp. Deletion size: 575 bp. Deletion left flank: TGAATACCGTTAATTTTTTTTTTTTAATTA. Deletion right flank: TTCGCTGAAAAATATAATTTCTTTCTGGTG. The allele gk3053 was identified by CGH and not confirmed by PCR. Left flanking probe: ATTTTACATTAGTCCGTGAATTTCAGATACTACGCCGGATATGCTGATAA. Right flanking probe: GCGCGGGATCAGTTTGGGTCAACTGTTATGATGTTTTTGATCCTGCTGCT. Left deleted probe: TATGCTGATAAAAACCACGGAAAAACCATTCCCGTCGGTGGAGACTATTT. Right deleted probe: TGAATAAAGCTCTTCAAGTCGCAAATACTATCCGCGCGGGATCAGTTTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK617.3. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2593 homozygotes (often sterile or nearly sterile, but population can be maintained). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCTGCACCTAACAATCAGC. External right primer: CAAGCGAACAGCAGTCACAT. Internal left primer: GCTTGAATTTTTGACTGTGGC. Internal right primer: GTTGTCGAATTATTGCGGCT. Internal WT amplicon: 1167 bp. Deletion size: 416 bp. Deletion left flank: AATTATTTCTCACTCTTTGAAATTATCAAG. Deletion right flank: TTAGTATTCTGGATGTTTGAGTGAGTAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37E3.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2787 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGAAAAATATCGGGCTTCAA. External right primer: CCTTCCAATCTGTCCAGGTG. Internal left primer: GCCATCTATCTCCCAAATCG. Internal right primer: ATTAAACCCCCGCTAAATCG. Internal WT amplicon: 1121 bp. Deletion size: 534 bp. Deletion left flank: CTCAAAATCTTGCTATTTTCCTTTGTGATC. Deletion right flank: GCGGATTGTTCCGCCTTTTCTGTAAGTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26E6.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2893 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGAAGCATGGCAAGAAGCAT. External right primer: GCTTTCTTTTGATCACCCCA. Internal left primer: ATGTGCAGCGAATTGTTGAG. Internal right primer: GACGCAGACATCAAGAGCAA. Internal WT amplicon: 1187 bp. Deletion size: 331 bp. Deletion left flank: GATTATGATTGTGTTCCGAGCGCTGGGATT. Deletion right flank: GGAAACAAAAGACTGGATTTAGCCGGACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06B8.7. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 680 bp. Deletion left flank: GCTTAAAGCAGGAGAGACCAAAGCGTGCTT. Deletion right flank: TCTCCGAATGATCGTATCACACTGGCCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41G3.10. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2840 homozygotes (sickly Unc with small broods, often Dpy, various morphological defects; population can be maintained with difficulty). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGATCATTCGAGTGGGAAGA. External right primer: GTCCACTAAACTTTGCCCCA. Internal left primer: AAATTGAGGATGGATGACGC. Internal right primer: AAACTCCCACGAAATCATGC. Internal WT amplicon: 1146 bp. Deletion size: 795 bp. Deletion left flank: TGTTGCAATAAGAACGCATAGCTGTACAAT. Deletion right flank: GTGTCTAACTGTGAACGAGTGGGCTTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27H6.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2847 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTCCACGTCCTCTACCTGA. External right primer: GTCAAGGGACTCGGAATTGA. Internal left primer: TCTTCCACACGTTTGAGCAC. Internal right primer: CTACAGGCTGCTGGATTCGT. Internal WT amplicon: 1221 bp. Deletion size: 780 bp. Deletion left flank: CTCGAGCGCGCGATAGAGATAGGTAAAACA. Deletion right flank: AGCAATCAATACAGCTCGTCCGGCCATACA. Insertion Sequence: ATCAATACAATCAATACAATCAATACATCAATACAATTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10D2.4, K10D2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2757 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 713 bp. Deletion left flank: AGGCTGAAACAACCTTCATTTTACTTTTGC. Deletion right flank: AATGAAGTATATTAGGCCCTTCGTATTGCT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54G11A.14. External left primer: TCAGACCGGTCATGGTACAC. External right primer: GGCGCTACTCCACTTTTGAA. Internal left primer: AAAACGCGAAACTATCGAAAA. Internal right primer: AAAAACTTACGCCATCGCC. Internal WT amplicon: 1138 bp. Deletion size: 686 bp. Deletion left flank: AAATTCAGGATCTTGGCTCCTGGAACGCAA. Deletion right flank: TTCTTGTGGCGCGAGTTGGATGCGGAGGAG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12A7.5. External left primer: GAAAATATTCGGCCTGCAAA. External right primer: GCACCAGTAGAGAACGGCTC. Internal left primer: CGAGTGCTAACTGTGGTTGC. Internal right primer: GGAATTTGACTGGAAAAGGG. Internal WT amplicon: 1155 bp. Deletion size: 436 bp. Deletion left flank: ATCTATCGAGAACTTCAAAAAGTTTGTGTG. Deletion right flank: TTTTTCAACAAGAATTTATCTTAAACTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGA TTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGT GTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71G12A.3. External left primer: AGGCGACTTCTCTCCCTCTC. External right primer: TCATCATTATCGCCGATTCA. Internal left primer: GTGTGTGTGTGTGTGTGCGT. Internal right primer: TCCTTTCCACCAACGGATTA. Internal WT amplicon: 1267 bp. Deletion size: 861 bp. Deletion left flank: CAGATGACCTTACCCGTTATAACTTTAACC. Deletion right flank: TGGATAAGCTGCCGATTCCACTCAAGGAGA. Insertion Sequence: GATAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04G2.8. External left primer: TGTCCTGGGTAGGTTGGGTA. External right primer: ATCCCGAATCTGTCCAATCA. Internal left primer: GACCTTTTCACGAGGCAATC. Internal right primer: GGTCCTTCGACAACCATAGC. Internal WT amplicon: 1315 bp. Deletion size: 407 bp. Deletion left flank: ATTGAAAACGATTGGATAGAGAAGTCAGCG. Deletion right flank: AATAAGAGCGACTTCTGGAGCGGCTTCTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 795 bp. Deletion left flank: ATCAGTGAGCACTGAAACTGCCAAAAAAGC. Deletion right flank: AATGACCAAATTCGAAGAGAAAATGGATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C32D5.2. External left primer: GCGTTGATCCAAAGGACAGT. External right primer: CAACTTTACGCTGCGATTGA. Internal left primer: TCGCAAAGCTCTGTATCGTG. Internal right primer: TCGGGGTTTTTGATCAACTC. Internal WT amplicon: 1159 bp. Deletion size: 304 bp. Deletion left flank: GTGGGAAGTTGCAATCAGGGTTGAGGTATG. Deletion right flank: GAAAAACGTCCCAGCACTTAATGAATTGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25F6.6. External left primer: AAAGACGATGGAGGCAAATG. External right primer: CCCCTAGGTGGCTTGACTTT. Internal left primer: CAACATCTTCACCGTCACCA. Internal right primer: CAACGTCACAATTCACTTGC. Internal WT amplicon: 1278 bp. Deletion size: 365 bp. Deletion left flank: CAAACTTCTGAGTGAAAAGTTTAATGTCAG. Deletion right flank: ATCATCATTTGGGAAAAAGGAGTGGATCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807