Search Strains

More Fields
Strain Species Genotype Add
VC2199 C. elegans rab-5(ok2605) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26H9.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2605 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTGCTGAAAACCGTCACAA. External right primer: GCTCATTCACTGGCTGAACA. Internal left primer: TTGCGTTGATTTCGAAGTTT. Internal right primer: TTCGAGGGGAAAACAATGAC. Internal WT amplicon: 1186 bp. Deletion size: 359 bp. Deletion left flank: GAAAGACGTAAAAACGTTAATAATTAAGAA. Deletion right flank: ATAAAAACATGTTAACAGAGTACTGAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC220 C. elegans cmk-1(ok287) IV; gkDf56 Y102A5C.36(gk3558) V. Show Description
This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCT AGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2200 C. elegans grl-22(ok2704) III. Show Description
W03A5.3. External left primer: TGACGGTGAGGACGTATTGA. External right primer: GCCACCGGATAGTTTTTCAG. Internal left primer: GGAGAAGATCATTGCCGAGA. Internal right primer: AAGTTGCCTTGAAAGTTTCCATA. Internal WT amplicon: 1221 bp. Deletion size: 573 bp. Deletion left flank: CGAGTCCGAAGGGGTGGATTTCATGTTCTG. Deletion right flank: CATTCTGCAAATGAAGGTTCTGAAGAAAAT. Insertion Sequence: TTCTGCAAATGAAGGTTCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2202 C. elegans T05G5.8(ok2864) III. Show Description
T05G5.8. External left primer: AGAGCAGCATCACAAGTGGA. External right primer: CTGGAAAAGGGGGACAAAAT. Internal left primer: CAACATCCTGAACTAAAACCTGG. Internal right primer: TATGTGTAGAGTGGCGGCTG. Internal WT amplicon: 1123 bp. Deletion size: 373 bp. Deletion left flank: CCAGGAACTCATTTAAAGTTTTCTCTTGAG. Deletion right flank: TTGCTGTTCGATGAACCATTTTACAAAGTT. Insertion Sequence: TATTTATAAATACATCCAAGAAAGTATCAAAAACACTCCAAATAGCTTTTTCGAATGAA A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2203 C. elegans taf-9(ok2871) III. Show Description
T12D8.7. External left primer: ACGATTCTCACGGAAACGTC. External right primer: AAGGTGGCTCCAAACAACAC. Internal left primer: TTCCATTAATTTCCTCGGCA. Internal right primer: TTCTACCCCGCATTTTTCTG. Internal WT amplicon: 1258 bp. Deletion size: 427 bp. Deletion left flank: GCCCAACGATCGATTCTGTCAATTACAGCA. Deletion right flank: ATTTTCCGACACTACTTGAATAACCCCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2204 C. elegans unc-122(ok2882) I. Show Description
F11C3.2. External left primer: CCCATTCACATTTTCAGGCT. External right primer: TGCCGCACACCAATAATAAA. Internal left primer: CCGGCGAAATAGGAAATGTA. Internal right primer: ACTTCCTGCGGAAGAAACCT. Internal WT amplicon: 1145 bp. Deletion size: 327 bp. Deletion left flank: TGATCACAAAAATCAAGAACTCTCAGAGAA. Deletion right flank: GAAAAAATGGTTCCTGTGCCAGTAGTGGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2205 C. elegans citk-2(ok2885) II. Show Description
F59A6.5. External left primer: CAACAACGAATCACACGAGG. External right primer: CCACTTTGCGTTGACTCTCA. Internal left primer: TGGACGCTGAGAACATCATC. Internal right primer: GATTCGAACCACCATCTCGT. Internal WT amplicon: 1323 bp. Deletion size: 693 bp. Deletion left flank: CAAGAACGACATGAAAGAGAACGATCGCAA. Deletion right flank: AACATTTGATTATGGCCGACCAACAGTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2206 C. elegans C33A12(ok2888) IV. Show Description
C33A12. External left primer: CGTTGAGAGCTCCACACAAG. External right primer: GAAATTGAGCACAAAAGGGG. Internal left primer: TGCATAACGGCTTCAGTCAT. Internal right primer: GCTAGCGAGCCTCTTACAGC. Internal WT amplicon: 1141 bp. Deletion size: 344 bp. Deletion left flank: TACCAAATGGGTGCAACTTTGTAATATAAT. Deletion right flank: CTAACTGACATGCCAAAAAATCTGCGCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2208 C. elegans C05D9.7(ok2931) X. Show Description
C05D9.7. External left primer: ATGGAATGCAGAAAAATGGC. External right primer: GCCCAAAATTACTGCCAAAA. Internal left primer: CTGGCGGATGATACCAATGT. Internal right primer: AAACCTCGTCGTACGCTTGT. Internal WT amplicon: 1252 bp. Deletion size: 815 bp. Deletion left flank: AATTTCACATTGGAATCAAAATAACTATGC. Deletion right flank: GAAGAAAGAAAAGAAAAAAATTGCAACGAC. Insertion Sequence: GGAGCATATTTTGGACAATGTTATTGAGAATTTTTTTTTGTAAAATTTTTCGAAACAGC CGAAAAAACCAATAACTCGGCTGTCGGCTGACGCCGACAGCCGAAACGAGGCCAATTTC TCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2209 C. elegans lgc-46(ok2949) III. Show Description
Y71D11A.5. External left primer: CCAGTTTCAGCTGTGTCGAA. External right primer: GTTTTGCACGTACTTCCACG. Internal left primer: AAACTAGGCTTGTTGGGGGT. Internal right primer: CGAAGCTAATAATGGTGCCAA. Internal WT amplicon: 1314 bp. Deletion size: 492 bp. Deletion left flank: TCCCGGGAGAGGTAGCCGACCCAGGCGAGT. Deletion right flank: AACTCCCACGAATTTCTAGATAAACTCACT. Insertion Sequence: CCCACGAATTTCTAGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2210 C. elegans C12C8.2(ok2954) I. Show Description
C12C8.2. External left primer: GATGCGGAAATCCAACAACT. External right primer: TCAAATGCAATCATTCCAGC. Internal left primer: AATGAGATAGAAGGCGGTGC. Internal right primer: GCATATTGATGCTGTGGGTG. Internal WT amplicon: 1191 bp. Deletion size: 694 bp. Deletion left flank: CTGTTGACGTTGAAAAAGAAAAGGATTTTG. Deletion right flank: AGTTGTTACAGTATCATCTTATGATAATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2211 C. elegans pqn-90(gk989) IV. Show Description
Y73F8A.8. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 519 bp. Deletion left flank: AAGCTGGTGCAGATGGAAGTGTGCATTGTG. Deletion right flank: AAGATTGACACTCATTCATAGATGGAGCAA. Insertion Sequence: ATTGACACTCATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2212 C. elegans pqn-90(gk999) IV. Show Description
Y73F8A.8. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 544 bp. Deletion left flank: TTGTCTGGCATGGTTGAGTACATTCCTGAT. Deletion right flank: TTGTTGGCATGAACAACTTGGTTGAACTTG. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2213 C. elegans C54E4.2(gk1003) IV. Show Description
C54E4.2. External left primer: TTTTTGACGACCAACCAACA. External right primer: CGAGGCTCTTTACGCAATTC. Internal left primer: CGCAGCGAACAAAGTTATGA. Internal right primer: CGTGGCGAGACCTATAAAGC. Internal WT amplicon: 1288 bp. Deletion size: 469 bp. Deletion left flank: TTTTTTTTTTTGGAGCTTCAGTTGAAGTTG. Deletion right flank: AGTCTCAGGAATGCAATTATAATTAGATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2214 C. elegans nhr-178(gk1005) V. Show Description
F16B4.9. External left primer: ACATCCATCTTTCTGGCGAC. External right primer: TTCGGAGTCACAAGTTGCAG. Internal left primer: GCGCACCCTGAACATAGTTT. Internal right primer: AAATATGGGAGCAGCGTTTG. Internal WT amplicon: 1511 bp. Deletion size: 626 bp. Deletion left flank: TGCACAGTCTGCATTGATATCTAAAATCGC. Deletion right flank: AAAAATATCAAACCTTATTTATCCGGCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2215 C. elegans bed-3(gk996) IV. Show Description
T25H8.6. External left primer: GCTCCTTCACCAACACCATT. External right primer: CGAGTGTTTGAAGTCTGGCA. Internal left primer: CGTGCCGAGACTCATCTACA. Internal right primer: TTCAATTAACTGGGCTTCCG. Internal WT amplicon: 2248 bp. Deletion size: 925 bp. Deletion left flank: GACTTTCGAAGTCTTGAACACCTCACTTTT. Deletion right flank: GAAGCTTCAACTAAAATCTTTCCCCTGTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2216 C. elegans K10D2.4(ok2759) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K10D2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2759 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 658 bp. Deletion left flank: TTAAAATCTCAGCGGGAGTTTGATCAAATT. Deletion right flank: CATTGGGAAAGACGAACCGAATAATAGGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2218 C. elegans H19M22.3(ok2827)/sC1 [dpy-1(s2170)] III. Show Description
H19M22.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2827 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCCGTGACGCTTAAATGG. External right primer: ATAATTCAGTGCCCGAGAGC. Internal left primer: ATCTCCGACTACACCAGCGA. Internal right primer: AGCGTCCGTTGACTTGAGTT. Internal WT amplicon: 1135 bp. Deletion size: 538 bp. Deletion left flank: AGAAAAAAATCTAGCAGATTGCAAAATCTA. Deletion right flank: AGTGTGCAGTGAGCAGCTGCTGCGACAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2220 C. elegans K09H9.7(gk991) I. Show Description
K09H9.7. External left primer: TTGTGGAAACGGCTTAGACC. External right primer: AAACATTTCGAATTACGCCG. Internal left primer: GCGGTGAATCAGGAGATGAT. Internal right primer: TTTCAGGAAACCAGCGATTC. Internal WT amplicon: 1078 bp. Deletion size: 514 bp. Deletion left flank: AAATTCAACTAACATATATACACCTTAATA. Deletion right flank: ATCACTGATTCATGAATTCCATTCTCAGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2221 C. elegans Y71A12B.8(gk984) I. Show Description
Y71A12B.8. External left primer: TCAGGTGAGATGTCTGCGTC. External right primer: CTCGGCAATGTTTTCCAAAT. Internal left primer: CTGCCATACCTGGACGATCT. Internal right primer: CCCTATCCTATGCCTACGCC. Internal WT amplicon: 2070 bp. Deletion size: 460 bp. Deletion left flank: AAAGTTTTCGACGTATTCACCCATATCTGA. Deletion right flank: CAAAACTAAAACAGTAAAAAATTTTTAAAC. Insertion Sequence: TAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2222 C. elegans grl-8(ok2763) V. Show Description
ZC487.5. External left primer: CAAGAAGCCAACTCCTCGTC. External right primer: ACTTCGCGGTTTTCTTCTGA. Internal left primer: ACCCCATCCTTAAAACCGAC. Internal right primer: CCTCAGCCATCATTCCACTT. Internal WT amplicon: 1293 bp. Deletion size: 586 bp. Deletion left flank: ACTGGTTACGAAACTACCAGTTTTATCGTT. Deletion right flank: ACTTGTCACCCAACTTTTTCCACTTCTCCT. Insertion Sequence: TTATCGTTTTATCGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2223 C. elegans ZC434.7&ZC434.8(ok2797) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZC434.8, ZC434.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2797 homozygotes (grotty sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCATCACATCGACACTTCC. External right primer: AAGGAGCTTCTGACTGCTCG. Internal left primer: GAATCGAGACGAGACGGAAT. Internal right primer: AGAAGCACTTGACAAAGGACG. Internal WT amplicon: 1371 bp. Deletion size: 991 bp. Deletion left flank: AGAAACATTAAACGTTATAAAGTTGAAGTT. Deletion right flank: AAAAAGTAATTACATTTTTCTCTCCCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2224 C. elegans F46F11.11&ubl-5(ok2820) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F46F11.4, F46F11.11. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2820 homozygotes (viable but sickly). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAATCGGGACAGCTTCAGA. External right primer: CGCAAGTGTGAAACGCTATG. Internal left primer: AGCCATGATTTACAGGGTTCA. Internal right primer: TGCAGATTTTACCATACTTGCG. Internal WT amplicon: 3053 bp. Deletion size: 2291 bp. Deletion left flank: GTTACTGTACTTCTTTAAGGCGCACGCAAT. Deletion right flank: TCGACGCGCAAATGCAGACTTGCAATGTAA. Insertion Sequence: ACAATTGGAGATTTGAAATGTACGTAAAAACACACAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2225 C. elegans npp-6(ok2821) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F56A3.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2821 homozygotes (sterile with spiky vulva, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGGCCAATATTCGAGTTTC. External right primer: CGTGTCAGTAGCGTCATCGT. Internal left primer: CATTGCTCAACGCAATCACT. Internal right primer: GCTCGATCGTCTGAAAAACA. Internal WT amplicon: 1360 bp. Deletion size: 549 bp. Deletion left flank: ATGATGAAGAAAGAGGGTGGTTACGGACCA. Deletion right flank: CAATCACTCAAGCTTATTCTCAGGACAACA. Insertion Sequence: TATGGCTATGATGAAATTCGAGAGTGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2226 C. elegans cgt-3(ok2877)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59G1.1. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2877 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATTCTGGACAGCGTTTGCTT. External right primer: CCATGATTAAACCAGACGGG. Internal left primer: TCAATCCATTGGGCATTTTT. Internal right primer: GGAATTACCTGCAATGGCTC. Internal WT amplicon: 1331 bp. Deletion size: 689 bp. Deletion left flank: AGATAATAATTTATACGAGAATATAGAATC. Deletion right flank: GGTTTCGTCATTTCTCGATAGAATTTGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2228 C. elegans +/szT1 [lon-2(e678)] I; unc-97(ok2760)/szT1 X. Show Description
F14D12.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2760 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGCCAACTTTCAGTGGTT. External right primer: TGCGCTTTTTCAATTCTGTG. Internal left primer: CGACCACAACCATATCAACG. Internal right primer: CGTTTGCATGTTGGTTTCAT. Internal WT amplicon: 1239 bp. Deletion size: 516 bp. Deletion left flank: GGATGTTTCTGTTGTGAGATTTGCAATAAA. Deletion right flank: AACAGCACTTCCACAAGGTACTTGAAATAT. Insertion Sequence: AAGATTTGCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2229 C. elegans pfd-6(ok2785) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F21C3.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2785 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: ATTTCAACGCTGCTGGAGAC. Internal left primer: ATGATGGCTGACTTTGAGCA. Internal right primer: TGCAAAGTTGGTTTTCACGA. Internal WT amplicon: 1193 bp. Deletion size: 286 bp. Deletion left flank: GATGTAATTAGCAATGACTTTTAACATAGA. Deletion right flank: TGTCTGAGATGCTGGCTTCCACTCGTTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2231 C. elegans fbxc-24(ok2903) II. Show Description
R07C3.11. External left primer: CTTCATTTTCATCCTCCCGA. External right primer: CGCCTTTTGCAACTTTTCTC. Internal left primer: TATCCGCATTGGACTCCTTC. Internal right primer: CAAGTGTTCTGGAATATTGAATGC. Internal WT amplicon: 1192 bp. Deletion size: 497 bp. Deletion left flank: TCTTCATAAAGAGGGACTCTATCCGGCGAA. Deletion right flank: AAATTCAAGGTTTCCAAATGATCTATGCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2232 C. elegans his-70(ok2906) III. Show Description
E03A3.4. External left primer: TCCGTAAACTTTAGGCCACG. External right primer: TGTTCATTGAAATCACCGGA. Internal left primer: CCATCCACTGCAGACACAGT. Internal right primer: ACGTTTTTGAACGAAATGGG. Internal WT amplicon: 1317 bp. Deletion size: 370 bp. Deletion left flank: AAGAAACACGGGCATTGATCAAGATTTTAT. Deletion right flank: CGGGGAAAACCTTACGAGCAGCCTTCGTCG. Insertion Sequence: GATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2233 C. elegans Y38H6C.17(ok2930) V. Show Description
Y38H6C.17. External left primer: CCGGTTGCTTACATGCCTAC. External right primer: GATTCGCCAATCTTCCAAAA. Internal left primer: AAGCAATACGTACCGGTCTACA. Internal right primer: AAAGTTTCCAAATTTTTCGGC. Internal WT amplicon: 1372 bp. Deletion size: 549 bp. Deletion left flank: ATTTATGACGTCATCAATACTGGAATATAA. Deletion right flank: ACAATTTTCCAGCAAAAACTTACACTGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2234 C. elegans sams-1(ok2947) X. Show Description
C49F5.1. External left primer: AGGACTTGCGAGAGTACGGA. External right primer: CTTGAGAGCTTTTGGCTGCT. Internal left primer: AGTGAATCTGTGTCCGAGGG. Internal right primer: GGGAACTCAGAGTGACCGAA. Internal WT amplicon: 1248 bp. Deletion size: 641 bp. Deletion left flank: TAGTTTATAGAATCTTGCTTTATTATTAGC. Deletion right flank: ATTGGTCAAGGCTGGACTTGCTAAGCGCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2235 C. elegans Y53G8AR.9(gk995) III. Show Description
Y53G8AR.9. External left primer: GCATTTCGCTTCTCCAACTC. External right primer: TCCGATTTTGAGCAATTTCC. Internal left primer: TCGTTCCAAATCCACATTCA. Internal right primer: TTTCCCTCCGATTTCTCTCA. Internal WT amplicon: 2634 bp. Deletion size: 1774 bp. Deletion left flank: GATTCTATAAAAATTGAGGCGAATTAGAGA. Deletion right flank: TCTACAAAAAATTGGGAATTTTTGGGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2236 C. elegans pbs-4(ok2856) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T20F5.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2856 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGCAAAAAGCTGCGATATG. External right primer: GCAAACAGCTGCTGAAACAA. Internal left primer: ATGCACTTGGCACCTTGATT. Internal right primer: CGGAAGAAAACTGGGAGAAA. Internal WT amplicon: 1272 bp. Deletion size: 675 bp. Deletion left flank: GTCAAATAGTGCGCATTGGGCGCGCACACC. Deletion right flank: ATTATGGATCGTGAATACAAAAAAGGTAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2238 C. elegans B0205.6(ok2890) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0205.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2890 homozygotes (sterile unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGAACAAAACCAGCAAT. External right primer: CCTGTCCTCCACCAGACATT. Internal left primer: CTCGAGTAGTCGACGCAATG. Internal right primer: GCTTCAATACGAACACGTGGA. Internal WT amplicon: 1094 bp. Deletion size: 255 bp. Deletion left flank: ACTGAATCAAATAATTTGGCGATTAAAGGA. Deletion right flank: ATATTTGGAAAATGAAGGATTTAAAGTGAC. Insertion Sequence: TTTTGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2239 C. elegans Y45F10D.10(ok2907) IV. Show Description
Y45F10D.10. External left primer: CGTCTCCACTAGCTCCTTGG. External right primer: GGAGTCCTCCGCAAACATTA. Internal left primer: AGATTTTTCGCTTTCCCTCC. Internal right primer: GCCAGAAACTCGCTTGAACA. Internal WT amplicon: 1318 bp. Deletion size: 546 bp. Deletion left flank: GGCATACGTCGTCAAAAGTATCAGCTCGAT. Deletion right flank: TTTGAATTAGAGAATTTATCTGGAAAATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2240 C. elegans acs-4(ok2872) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F37C12.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2872 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTTTCAGGCAAATTGGGT. External right primer: TTCCTGTGCTCAAGTCGTTG. Internal left primer: ATGTTTGGGAACTCGACAGC. Internal right primer: ATCCTTGAACAACAGGGCAG. Internal WT amplicon: 1170 bp. Deletion size: 335 bp. Deletion left flank: CTGAAGACCCTGATTTATTTCGCTCCTGTG. Deletion right flank: AATTTTTATTGGATTTAAAACTCATTTTAC. Insertion Sequence: CGAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2242 C. elegans C10G11.9(ok2839) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C10G11.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2839 homozygotes (grotty sterile or maternal-effect sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAATCGGTGGCTAGGTGAAA. External right primer: CTGGAAGGAGCACCCATAAA. Internal left primer: CATACACGACTGATATGCTTTCAA. Internal right primer: TGACCCTCTCAAGAAGAACGA. Internal WT amplicon: 1315 bp. Deletion size: 672 bp. Deletion left flank: CTGCTGGCTTCTGCTGCGGCTACGTCTTTT. Deletion right flank: TAAGCTTTTATAGTGAGCATTGATGACCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2243 C. elegans tufm-2(ok2850) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C43E11.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2850 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGCTATGAAAGTCCTCTGC. External right primer: CGACTCTCCCCGACATTTTA. Internal left primer: TATTCCCACACTGATTGCCC. Internal right primer: TGAGCAGATCAGGTAAAACTGC. Internal WT amplicon: 1303 bp. Deletion size: 499 bp. Deletion left flank: CGGATTTCATCAAAAATATGATTTGCGGAA. Deletion right flank: TGTTTTTCAGGAACAGTCATCGTCGGTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2244 C. elegans F59C6.2(gk981) I. Show Description
F59C.2. External left primer: AATGAGCTTGTTTGGATGGG. External right primer: GCTTCGAGGAAGAAACGAGA. Internal left primer: GCACAACCAGAGAGAAAGGC. Internal right primer: CCATCTCACCAAGCCCTAAC. Internal WT amplicon: 1657 bp. Deletion size: 605 bp. Deletion left flank: CGTTTTGTGCTCCTTATCTACATTTACTAC. Deletion right flank: GCTGGCCTCCATATTGTTTTAATAGATATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2245 C. elegans ZK1236.1(ok3023) III. Show Description
ZK1236.1. External left primer: TAATTGACCGTGTTCCAGCA. External right primer: TTGAGTCGTTCCATTCCTCC. Internal left primer: TATTTCGATCATTTTCGCGG. Internal right primer: CCACCAAAGTTTCCCTTCAA. Internal WT amplicon: 1179 bp. Deletion size: 508 bp. Deletion left flank: GGTTGGAGAGACACTTTTCGCTGAAACAAC. Deletion right flank: GATTCGACTCGTCTCGTGATCCTTTGGAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2246 C. elegans R13H9.5(ok2966) IV. Show Description
R13H9.5. External left primer: AATGAACTCAAAACGGGACG. External right primer: TGTAATGACGCTTGTCGGAA. Internal left primer: CGGTTCCAGTCCAGTCTGAT. Internal right primer: AGTCTTTGCAGGTAAATACGAGTT. Internal WT amplicon: 1219 bp. Deletion size: 424 bp. Deletion left flank: CGACATTTATAAAACCATTTATTCAAATCA. Deletion right flank: GTTCTAAAGGTCTGAAAATTATCAAATTAC. Insertion Sequence: TTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2247 C. elegans F28H6(gk959) X. Show Description
F28H6. External left primer: TAAATGATTGCGCCATTTCA. External right primer: TAAAAATCACCTTCCGCCAG. Internal left primer: TTCCACATCACGCAGCTTAC. Internal right primer: TTCCCTCGAATTCACATTCC. Internal WT amplicon: 2143 bp. Deletion size: 748 bp. Deletion left flank: GAACAAAATTGTAGAAAACCCAACTTGGTA. Deletion right flank: ACTCTTTTTACATTAAGTCCCACATTTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2249 C. elegans dod-19(ok2679) V. Show Description
ZK6.10. External left primer: ATCTTTGTCCATTGGCTTGC. External right primer: GTCAGTGGCACCAAAATCCT. Internal left primer: CAAACATGGTCTGTGACGCT. Internal right primer: CGTCGCCTTCCTGTATGC. Internal WT amplicon: 1223 bp. Deletion size: 757 bp. Deletion left flank: CGAAATTGTAACGGACACAAATAATTGAAC. Deletion right flank: TAGAAACTGTGCCCATGGGCTTCATATAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2250 C. elegans nstp-3(ok2873) V/nT1 [qIs51] (IV;V). Show Description
ZC250.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2873 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTATCCCAAATTCCCTT. External right primer: CGTTTCATTGGGATACCTGG. Internal left primer: TTTTTGCAAATTTCCATCCG. Internal right primer: AATCTTGGCATCCACCTCAC. Internal WT amplicon: 1225 bp. Deletion size: 429 bp. Deletion left flank: TTAATAGGAAGCTGAGAATGTCAATTTTTG. Deletion right flank: AACTGATGAAAAATGGAAGAATTTAGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2251 C. elegans C42C1.4(ok2912) IV/nT1 [qIs51] (IV;V). Show Description
C42C1.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2912 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCGCTCGGAGAGTTGTACC. External right primer: ACGTGCTACCGTAATCCGAC. Internal left primer: TCGCACTTACCGTATCCACA. Internal right primer: TGATCCTGAAAAGGGGACAG. Internal WT amplicon: 1205 bp. Deletion size: 429 bp. Deletion left flank: TTTCGAAAGAGAATCCATAGATAGTCGATC. Deletion right flank: TCCTTTAAGAATTGGTGTTGAAAAGACTAG. Insertion Sequence: TCAACAAGCTATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2253 C. elegans spe-17(ok2631) IV. Show Description
ZK617.3. External left primer: TGCTGCACCTAACAATCAGC. External right primer: CAAGCGAACAGCAGTCACAT. Internal left primer: GCTTGAATTTTTGACTGTGGC. Internal right primer: GTTGTCGAATTATTGCGGCT. Internal WT amplicon: 1167 bp. Deletion size: 557 bp. Deletion left flank: TTAGCTGAAGTATTGGAAAAATCTCAGAAA. Deletion right flank: TGGTTAGTATTCTGGATGTTTGAGTGAGTA. Insertion Sequence: AAAAAAATCAAAAAAATCTCAAAAAAAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2254 C. elegans ZC395.10(ok2968) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZC395.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2968 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTGCCCATGGAAACTGATT. External right primer: CAATGCCATTCGCACTTAAA. Internal left primer: GAAAAACGAATGCGGGATAA. Internal right primer: TCTTGCTTGTTATTGCCGTG. Internal WT amplicon: 1196 bp. Deletion size: 501 bp. Deletion left flank: ATCCGTTCGCCATTCCACCGCCAATTCCGG. Deletion right flank: TAATTCGAAAAGAGAACTAGACGGATACGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2255 C. elegans atp-2(ok3002) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C34E10.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3002 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGCCACCAAGGTTTGTAT. External right primer: CGGTAAGCTTGTCTTCCTCG. Internal left primer: AGGTCTCTGCCAAGGCTACA. Internal right primer: TTTGAACTCCACGAGCAATG. Internal WT amplicon: 1178 bp. Deletion size: 500 bp. Deletion left flank: CAAGGCTACAGCTGCTAACGCTTCCGGACG. Deletion right flank: GTTACTCTGTGTTCGCTGGAGTCGGAGAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2256 C. elegans eat-17(ok2928) X. Show Description
T24D11.1. External left primer: GGATTGAAGTGGCTTTCCAA. External right primer: AGAGTCAAATGCCGAAAAGC. Internal left primer: TTTTCAGGCAAAATGCAGC. Internal right primer: AGGCTCAAGTAGGCTCAAGTG. Internal WT amplicon: 1237 bp. Deletion size: 821 bp. Deletion left flank: TTGATACAACTTTTTTTTGCACAAAGAGAA. Deletion right flank: TTCTTCGGGCATCTGGAGGAGCAAGAGACC. Insertion Sequence: TCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2258 C. elegans cbd-1(ok2913) IV. Show Description
H02I12.1. External left primer: AAACCAGTAGCCCTCCGTTT. External right primer: TGGATCTTTCCCATTCTTGC. Internal left primer: TGCAGCGATGATTCTGTCTT. Internal right primer: GTCGAGGGATGAAGAATGGA. Internal WT amplicon: 1127 bp. Deletion size: 646 bp. Deletion left flank: ACTACGCCGACGGTTGCAATGACGTATTCT. Deletion right flank: CGTATCTTGAGAATCCATTCTTCATCCCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807