Search Strains

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs211 [vha-12p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).

foxSi27 [pie-1p::tomm-20(gDNA)::mKate2::HA::tbb-2 3'UTR ] I. Single-copy MosSCI insertion into oxti185. Germline-specific expression of TOMM-20::mKate2::HA can be used for fluorescent identification of germline mitochondrial morphology and tissue-specific isolation of mitochondria. Reference: Ahier A, et al. Nature Cell Biol. 2018 Mar;20(3):352-360. doi: 10.1038/s41556-017-0023-x. PMID: 29358705.

foxSi37 [ges-1p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Gut-specific expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi39 [gcy-6p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. ASE-specific expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi41 [dpy-7p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Hypodermal expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi44 [rgef-1p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Neuronal expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi75 [eft-3p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Ubiquitous expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi16 [myo-3p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Muscular expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

Worms are viable at 15C and dead at 24C.

Dies at 15-20C with mostly dead embyros and a few dead larvae. Grows best at 24C. Survives at 25C, but worms look sick (often small and clear) and have very reduced brood sizes. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

pxIs10 [pha-4::GFP::CAAX + rol-6(su1006)]. Roller line that has GFP localized to the plasma membrane of the pharynx, gut and rectal cells in embryos and the somatic gonad during L2-L3 larval stage and beyond. Reference: Portereiko MF & Mango SE. Dev Biol. 2001 May 15;233(2):482-94.

mnEx151 [smu-1::GFP + smu-2::3xHA + unc-36(+)]. Animals carrying the array should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Without the array smu-2(mn416) suppresses unc-52(e669su250) so animals don't show the Unc-52 phenotype. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.

mnEx156 [smu-2::GFP + smu-1::3xHA + unc-36(+)( R1p16)]. Maintain by picking non-Unc.

mnIs66 [smu-2::HA + unc-36(+)]. Strain should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.

Maintain at 15C. No Progeny at 25C; little response to blue light. References: Granato M, et al. Nucleic Acids Res. 1994 May 11;22(9):1762-3. Edwards SL, et al. PLoS Biol. 2008 Aug 5;6(8):e198.

sraEx230 [str-2p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AWC(on) was inhibited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx278 [npr-9p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx279 [ttx-3p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx281 [ttx-3p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx291 [npr-9p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx301 [str-2p::chop-2(H134R)::TagRFP + str-2p::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AWC(on) was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx306 [ser-2(prom2)::chop-2(H134R)::TagRFP + ser-2(prom2)::mKO + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses mKO and TagRFP in AIY, AIZ and RME in the head, and has little response to blue light in the absence of ATR. In the presence of ATR asymmetrical stimulation of AIY causes the worm to turn in the same direction the head was bent when AIY was excited, whereas asymmetrical stimulation of AIZ or RME causes the worm to turn in the opposite direction to which the head was bent when AIZ or RME was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx329 [odr-2(prom18)p::chop-2(H134R)::TagRFP + odr-2(18)p::mKO + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses mKO and TagRFP in SMB in the head, and has little response to blue light in the absence of ATR. In the presence of ATR asymmetrical stimulation of SMB causes the worm to turn in the same direction the head was bent when SMB was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

ssrIs1248 [ges-1p(deltaB)::rpl-22::3xHA + ges-1p(deltaB)::GFP + pSM(empty vector)]. ges-1p(deltaB) is an INT1-specific promoter. Strain can be used for INT1-specific RiboTRAP experiments. Generated in N2 background. Reference: Liu C, et al. bioRxiv 2025.10.03.680215; doi: https://doi.org/10.1101/2025.10.03.680215

ssrIs1251 [pho-1p::rpl-22::3xHA + pho-1p::mCherry + pSM(empty vector)]. pho-1p is an INT2-9-specific promoter. Strain can be used for INT2-9-specific RiboTRAP experiments. Generated in N2 background. Reference: Liu C, et al. bioRxiv 2025.10.03.680215; doi: https://doi.org/10.1101/2025.10.03.680215

ncEx9005 [lin-32p::FLAG::let-363 + lin-32p::Myc::daf-15 + lin-32p::HA::rict-1 + hsp16-2p::plx-1 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. KpnI sites were added by PCR to let-363, daf-15 and rict-1 cDNAs and inserted into pPD49.26 containing lin-32p followed by the FLAG-, Myc- and HA-coding sequences to generate lin-32p::FLAG::let-363, lin-32p::Myc::daf-15 and lin-32p::HA::rict-1, respectively. Reference: Nukazuka A, et al. Nat Commun. 2011 Sep 27;2:484.

ncEx9007 [unc-54p::FLAG::let-363 + unc-54p::Myc::daf-15 + unc-54p::HA::rict-1 + hsp16-2p::plx-1 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. KpnI sites were added by PCR to let-363, daf-15 and rict-1 cDNAs and inserted into pPD49.26 containing inserted into pPD30.38 containing unc-54p followed by the FLAG-, Myc- and HA-coding sequences to generate unc-54p::FLAG::let-363, unc-54p::Myc::daf-15 and unc-54p::HA::rict-1, respectively. Reference: Nukazuka A, et al. Nat Commun. 2011 Sep 27;2:484.

ccEx7271 [let-858::GFP + pha-1(+)]. This strain expresses nuclear-localized GFP in all somatic nuclei, but reduced or no GFP in germ cells. If maintained at 20C, pha-1(ts) genotype will select for transgenic animals. Germ cell expression can be observed when maintained at 25C. Germline transgene silencing is abnormal.

mjIs27 [mir-124p::GFP + lin-15(+)]. GFP expression in ~40 neurons, most of which are ciliated sensory neurons (AWC, AWA, AWB, ASH, ASI, ASK, PVQ (not ciliated), ASE, PHA, PHB, PVD (not ciliated), IL1, ADE, PDE). Reference: Clark AM, et al. Nucleic Acids Res. 2010 Jun;38(11):3780-93.

mjIs27 [mir-124p::GFP + lin-15(+)]. GFP expression in ~40 neurons, most of which are ciliated sensory neurons (AWC, AWA, AWB, ASH, ASI, ASK, PVQ (not ciliated), ASE, PHA, PHB, PVD (not ciliated), IL1, ADE, PDE). Reference: Clark AM, et al. Nucleic Acids Res. 2010 Jun;38(11):3780-93.

PHA and PHB dye-filling defect. About 50% athermotactic. ch3 deletes exon 3, causes frameshift and premature stop. [NOTE: Miyazaki, et al. (2022) report that this strain carries the fln-2(ot611) mutation in the background.]

ddIs15 [C47B2.3(genomic)::YFP + unc-119(+)]. Alpha tubulin::YFP.

tmIs905 [dat-1p::alpha-synuclein(A30P) + ges-1p::DsRed] II. egIs1 [dat-1p::GFP]; reportedly maps to LG IV. hrpr-1 also known as hrp-2. yyz8 is a weak loss-of-function allele. Neurodegeneration in ADE neurons. Neurites are shorter in PDE neurons.

tmIs905 [dat-1p::alpha-synuclein(A30P) + ges-1p::DsRed] II. egIs1 [dat-1p::GFP]; reportedly maps to LG IV. yyzSi1 [dat-1p::hrpr-1(genomic)::hrpr-1 3'UTR + HygR]. Transgene expression in dopaminergic neurons rescues yyz8 phenotype. hrpr-1 also known as hrp-2.

Temperature sensitive. Wild type at 15C; lethal at 22.5C.

Isolated from the soil in a kabocha pumpkin patch garden (Baermann funnel method) in Kurtistown (native Hawaiian place name: Ola'a), Hawaii Island, on June 24, 2008.

leEx1606 contains [aha-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leIs6 [vha-8::lacZ + rol-6(su1006)]. Rollers. This strain shows B-galactosidase expression in the excretory cell and lateral nuclei of the hypodermis adjacent to the anterior and posterior branches of the excretory cell. The second component to this expression pattern appears to be localized in the hypodermis adjacent to the excretory canals. B-galactosidase was seen in the nuclei from late embryogenesis through to the adult. plasmid name: pUL#64A1. Partial Sau3A fragments cloned into BamH1 site of vector. Plasmid backbone: pPD22.11. A 2.7 Kb HindIII fragment from the insert of pUL#64A1 hybridized to YACs Y55E11, Y53F3, Y50C9, and Y73B6 which overlap on LGIV. References: Young JM, Hope IA. Dev Dyn. 1993 Feb;196(2):124-32. Hope IA, et al. Mol Gen Genet. 1998 Nov;260(2-3):300-8.

xtEx84 [ftn-1p(DR1m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

xtEx88 [ftn-1p(DR2m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

xtEx94 [ftn-1p(DR3m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

xtEx257 [ftn-1p(DR123m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

xtEx448 [ftn-1p(DR123ACm)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

xtEx61 [ftn-1p(G1m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

xtEx66 [ftn-1p(G2m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

xtEx72 [ftn-1p(G12m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

xtEx79 [pes-10(+63)::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

Y38F2AL.4. Superficially wild type. External left primer: GGTGAAAAATCGGGGAAAAT. External right primer: GCGATGACAACTATTGGGCT. Internal left primer: TTTAGCTCAAAATTTGCCCG. Internal right primer: ATGTGCTGCGACTTCCTTCT. Internal WT amplicon: 2580 bp. Deletion size: 710 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35H10.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1588 homozygotes (arrest stage/phenotype undetermined). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807