Search Strains

otEx7488 [ceh-45::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.

otEx7489 [nsy-7::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.

otEx7569 [ceh-81::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.

otEx7570 [ceh-91::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.

otEx7571 [ceh-99::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.

otIs779 [unc-7(fosmid)::SL2::YFP::H2B + pha-1(+) + myo-2p::BFP]. Derived by integration of otEx7106.

otEx7603 [nlp-52p::GFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. The nlp-52 reporter construct contains the full intergenic region of nlp-52 as the promoter. GFP expression in a subset of cells of the nervous system. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.

otEx7647 [ttll-9p(500 bp)::GFP + pha-1(+)]. Maintain at 25C to retain array. OLQ neurons are marked with GFP. Can be used to isolate OLQ by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otIs518 [eat-4(fosmid)::SL2::mCherry::H2B + pha-1(+)]. otIs773 [inx-19(fosmid)::SL2::YFP::H2B + unc-122::GFP + pha-1(+)]. Integrated fosmid transcriptional reporter for inx-19.

otEx7693 [F23H12.7p(RIM)::tagRFP + pha-1(+)]. Maintain at 25C to retain array. RIM neurons marked with RFP. Can be used to isolate RIM by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otEx7568 [nlp-17::GFP + pha-1(+)]. Maintain at 25C to retain array. PVQ neurons marked with GFP. Can be used to isolate PVQ by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otEx7567[nlp-56p::GFP + pha-1(+)]. RMG neurons are labeled with GFP. Can be used to isolate RMG by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otIs879 [sri-1p::NLS::GFP + pha-1(+)]. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

otEx7947 [W02A2.5p::GFP + pha-1(+)]. I3 neurons are labeled with GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otEx7948 [lgc-8p::mNeonGreen::PH::p10 + pha-1(+)]. I1 neurons are labeled with mNeonGreen. Can be used to isolate I1 neurons by FACS (green-only). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otIs355 [rab-3p(prom1)::2xNLS::TagRFP] IV. otEx7950 [clec-166::GFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. Pan-neuronal nuclear RFP expression. Co-expression of GFP and TagRFP in M5 neuron can be used to isolate M5 by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otEx8029 [ceh-19(prom 2)::GFP + pha-1(+)]. Maintain 25C to select for array. Modified ceh-19 promoter fragment drives bright expression of GFP in MC L/R. There is also expression in an additional unidentified cell in the tail but this expression is much much dimmer and typically not visible under the dissecting scope. GFP expression in MC can be used to isolate MC by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otEx8047 [pks-1p::TagRFP + pha-1(+)]. Maintain at 25C to select for array. TagRFP expression marks CAN neurons.

otEx980 [dop-2::GFP + pha-1(+)].

otEx8199 [sshk-1p::GFP + pha-1(+)]. Maintain at 25C. 370 bp of promoter directly upstream of sshk-1 fused to GFP. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329

otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. TIR1(F79G) expression in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

otIs913 [pha-4(prom2)::daf-2(DN)::eBFP2::tbb-2 3’ UTR + unc-122p::mCherry::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. pha-4(prom2) drives expression of daf-2(DN) in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

otEx1043 [dop-1(prom2)::GFP + pha-1(+)].

otEx233 [dop-1(prom1)::GFP + pha-1(+)].

otEx193[C09E7.3(oig-1)::GFP].

otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2414 [gcy-17(prom1)::GFP + unc-122::GFP]. Expresses GFP in PHA. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.

otEx239 [C53B7.1::GFP + pha-1(+)]. Maintain by picking GFP+. At 25C, only animals with the array should be alive.

nuIs11 [osm-10::GFP + lin-15(+)]. Array contains pool28; KP#57-59 (osm-10::GFP insert at Nrul site) and pJM24 [lin-15(+) rescues n765 at 20C]. GFP expressed in ASH, ASI, PHA and PHB after 3-fold. nuIs11 may be inserted on LG I.

otEx536 [ser-2(prom2)::GFP + pha-1(+)]. Maintain at 25C to select for transgenic animals.

ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp16-2p::che-1::3xHA::BLRP + rol-6(su1006)] V; injected as complex array with Pvu II bacterial DNA. Rollers. Rol is prone to silencing in otIs305, but hsp transgene is still active in Hobert Lab assays. otIs305 is homozygous by PCR analysis (Hobert). Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.

wgIs124 [aha-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs37 [pha-4::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of pha-4 coding sequence of fosmid ID#WRM0617dE06 by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs687 [pha-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

pkIs2386 [unc-54p::alpha-synnuclein::YFP + unc-119(+)].

pkIs2386 [unc-54p::alpha-synnuclein::YFP + unc-119(+)].

ccEx7271 [let-858::GFP + pha-1(+)]. This strain expresses nuclear-localized GFP in all somatic nuclei, but reduced or no GFP in germ cells. If maintained at 20C, pha-1(ts) genotype will select for transgenic animals. Sporadic germ cell expression can be observed when maintained at 25C.

GFP inserted at N-terminus of endogenous vha-13 locus. GFP expression in the intestine and other tissues. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628.

Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID* after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.

Conditional knockout of dmsr-1 created via consecutive insertion of two FRT sites (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC) flanking the second and third exons. The sequence within the two FRT sites is predicted to encode the first four transmembrane alpha helices. FLP recombination excises this sequence and introduces a frameshift, resulting in a likely molecular null allele of dmsr-1. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

wrmScarlet inserted at N-terminus of endogenous vha-13 locus. wrmScarlet expression in the intestine and other tissues. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc lethal at 25C. Difficult to score <25C.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Slow movement at 25C; might not curl like cha-1 typically does. Very slow movement at 20C. unc-68 channel null.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. jIs1 [myo-3::GFP + rol-6(su1006)]. jIs1 likely maps to LGI, LGII, or LGX. Rollers; not all animals roll well.

3xHA::TurboID tag with GGCG linker sequence inserted at the N-terminus of the endogenous NHR-49 gene (long isoform c). Derived by out-crossing parental strain PHX10203. Reference: Tatge L & Douglas PM. MicroPubl Biol. 2025 Aug 1. doi: 10.17912/micropub.biology.001655.

Structural gene for choline acetyltransferase (ChAT). Slow growing. Unc-coils, jerky going backward. Small. Resistant to aldicarb and trichlorfon. 99% reduced choline acetyltransferase. Complex complementation pattern with unc-17.

Temperature sensitive. Unc-difficulty in crawling backwards. Behavior phenotype more pronounced at 25C than at 16C or 20C. Trichlorfon resistant. This strain replaced strain DH401 because Mike Nonet tested DH401 and found it didn't contain cha-1, but did have an unc-11 mutation (5/97).

Mild (leaky) allele of cha-1. Has approximately 10% WT ChAT activity. Behaviorally normal-normal growth and development. Males mate. Sensitive to cholinesterase inhibitor aldicarb.

syIs9 [pJMGoQL + (pMH86) dpy-20(+)]. Phenotype of dominant activated Go alpha is lethargic and egg-laying defective - phenotype increases in severity as animal matures and ages. Animals frequently wander to the side of the plate. Animals move with decreased amplitude of sinusoidal waves. Dpy and WT revertants are frequent. Linkage unknown. Do not distribute this strain; other labs should request it from the CGC.

syIs197 [hs::LIN-3c(cDNA) + myo-2p::DsRed + pha-1(+)]. Him. Maintain at 15C. To induce LIN-3/EGF expression, heat shock at 33C for 30min (water bath) and let animals recover at least 1hr from the behavioral effects of the heat shock. Heat shock-induced LIN-3 should inhibit feeding, locomotion and sensory responses for several hours. For details on EGF-induced quiescence, see Nature Neuroscience 10, 1300 - 1307 (2007). PS5970 is identical to PS5628 as described in Development 137, 2065-2074 (2010) except that it has been outcrossed to remove accumulating suppressors.

syEx1147 [des-2::DES-2::GFP + pha-1(+) + pBluescript KS(+)]. Maintain at 25C to select for presence of transgene. GFP reporter is driven by the promoter of the des-2/des-3 operon and is expressed in ALA, RID, PVD, FLP, IL2, PLM, PVC, and M1 muscles of the pharynx. This construct contains 3.4 kb of sequence upstream of the des-2 start ATG (Treinin et al., 1998) (Van Buskirk and Sternberg, 2010).