Search Strains

teIs98 [(pRL1450) pie-1p::GFP::sys-1 + unc-119(+)].

yIs34 [(pMN15.1) xol-1::GFP + rol-6(su1006)]. Pick Rollers. xol-1::GFP translational fusion with sXO-specific expression. Strain gives some non-Rollers, which represent silenced arrays.

ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Histone and tubulin GFP.

cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Weak Rollers. Dauer constitutive at higher temperatures. Maintain at 15C.

qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP y402 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.

cuIs5 [myo-2c:: GFP + rol-6(su1006)]. Rollers. GFP+ in pharynx.

cuIs5 [myo-2c:: GFP + rol-6(su1006)]. Daf-c. Maintain at 15C. Rollers. GFP+ in pharynx. Reference: Reiner DJ, et al. (2008) Current Biology 18(15):1101-9.

cuIs5 [myo-2c::GFP + rol-6(su1006)]. Rollers. GFP+ in pharynx.

mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Him. mIs10 suppresses recombination between unc-60 and dpy-11.

qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP s939 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.

Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF, et al. Genes Dev. 2009 Aug 1;23(15):1763-78.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, htp-3(y428) ccIs4251 homozygotes that are GFP+ in body wall muscle but not pharynx, hT2 GFP+ homozygotes, and aneuploid dead embryos. Avoid picking viable aneuploids that often appear larger and longer than wild-type.

Segregates WT GFP+ heterozygotes, GFP- tm3655 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Avoid picking viable aneuploids that often appear larger and longer than wild-type.

Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.

Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile rec-8(ok978); coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.

Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF & Meyer BJ. 2014. eLife. 2014 Aug 29;3:e03467.

Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF & Meyer BJ. 2014. eLife. 2014 Aug 29;3:e03467.

syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Heatshock induces expression of lacI::GFP in the soma, which binds to integrated lacO arrays. lacI::GFP expression is silenced in the germline. Derived by out-crossing PS2442 to remove e1282. Reference: Severson AF & Meyer BJ. Elife. 2014 Aug 29;3:e03467.

baEx2 [lis-1::GFP + rol-6(su1006)]. Maintain by picking Rollers.

baIs13 [nud-1::GFP + rol-6(su1006)]. Rollers.

baIs4 [dat-1p::GFP + dat-1p::CAT-2]. GFP expression in CEP, ADE and PDE neurons. From integration of baEx33.

Pick slightly dumpy GFP+ to maintain. Heterozygotes are slightly dumpy GFP+ (pharynx), and segregate slightly dumpy GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), non-GFP udn45 homozygotes (early larval arrest and Unc), and a few slow-growing wild-type looking or thin GFP+ heterozygotes. These thin GFP+ animals give rise to almost exclusively GFP+ progeny; a possible interaction between unb45 and qC1 is suspected. Variant edit allele T90I. TspRI restriction site created by synonymous changes for ease of genotyping. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.

Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), and non-GFP gk5722udn86 homozygotes (larval arrest; few escapers). Derived from VC4653; selection cassette in VC4653 was removed, and then crossed with qC1 nIs189 [myo-2::GFP] balancer. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.

popl-5 [S99I]/tmC29 III. Variant edit. Lethal mutation balanced by tmC29. Balancer marked with myo-2p::GFP. Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP popl-5 [S99I] homozygotes (larval lethal), and Unc GFP+ tmC29 homozygotes. Pick fertile wild-type GFP+ to maintain. NOTE: udn113 homozygotes are partially L3 larval lethal: some homozygotes can develop into sterile adults with protruding vulvae. Pick fertile GFP+ to maintain. AvaII site added in S99I allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658

jsSi1606 [loxP::unc-116(+)::FRT3] II. Single copy unc-116(+) insertion at the standard Chr II ttTi5605 mosSCI site. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/).

popl-5 [S99S]/tmC29 III. Control edit mutation maintained over tmC29. Balancer marked with myo-2p::GFP. Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP popl-5 [S99S] homozygotes (viable and fertile), and Unc GFP+ tmC29 homozygotes. Pick fertile wild-type GFP+ to maintain. NOTE: udn109 is essentially wild-type. Pick GFP+ to prevent non-GFP popl-5 [S99S] homozygotes from taking over the population and losing the balancer! Silent AvaII site added in S99S allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658

oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. Maintain at 15C. Temperature-sensitive embryonic lethal. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi13 [par-5p::GFP::par-5::par-5 3' UTR(splice bias) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

ddIs26 [pie-1p::mCherry::par-6 + unc-119(+)]. oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. axIs1929 [nmy-2::GFP + mCherry::par-2]. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi17 [par-5p::GFP::par-5::par-5 3' UTR(mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the long PAR-5 3'UTR isoforms (utr.1 and utr.2). Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi20 [par-5p::GFP::par-5::par-5 3' UTR(mutated splice sites, mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.1 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi24 [par-5p::GFP::par-5::par-5 3' UTR(truncated) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.3 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi40 [par-5p::par-5(partially recoded)::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of partially recoded par-5 fused to GFP under its endogenous regulatory sequences to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

gqIs37 [unc-47::ppk-1 + myo-2::GFP] II. oxIs12 [unc-47p::GFP + lin-15(+)].

muIs32 [mec-7p::GFP + lin-15(+)]. gqIs25 [rab-3p::ppk-1 + lin-15(+)].

juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. 7xGFP11 tag inserted into endogenous unc-9 locus. unc-9(miz81) is Unc, possibly due to increased channel activity. Reference: Hendi A, et al. Elife. 2022 Nov 15;11:e80555. doi: 10.7554/eLife.80555. PMID: 36378164.

7xGFP11 tag inserted at 5' end of endogenous syd-2 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.

7xGFP11 tag inserted into endogenous elks-1 locus. ELKS-1::7xGFP localizes to tip of synapses similar to CLA-1. miz365 genotyping primers: F: TACCGGCTCCAGTGATTCC / R: tgtgtgccattggatgtgag (wt = 203bp, mutant = 676bp). Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.

7xGFP11 tag inserted into endogenous unc-10 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.

7xGFP11 tag inserted into endogenous cla-1 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.

7xGFP11 tag inserted into 5' end of endogenous rimb-1 locus using CRISPR/Cas9. Reference: Kurashina M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.

mizIs41 [mig-13p::mScarlet1-10::SL2::GFP1-10 + odr-1p::GFP]. 4xmScarlet11 tag inserted into endogenous sng-1 locus. miz488 genotyping primers: F: CGCACCTCCACCTCAATCC / R: AACACAACAAGACGGAAATACG. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.

leEx1423 [mxl-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1432 [hlh-10::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1435 contains [hnd-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1439 [mxl-3::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1444 [hlh-29::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.