| VC4056 |
C. elegans |
igcm-4(gk5130[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2727 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTATTGTTTCTTTGTTGAATATGGTATG ; Right flanking sequence: TCTTTACCTGCTCTCCATTTTTAGACCATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4058 |
C. elegans |
gcst-1(gk5132[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27P::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1302 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCACACTGCTCAATGCGTCGCGCTGCTTCT ; Right flanking sequence: ATTTCCCTGGAGCTGAACATATTGTGAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4060 |
C. elegans |
ech-1.1(gk5134[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2429 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTGGTTTTAGCTATAAAATTGTCCTCCA ; Right flanking sequence: TGCGGTAGTGACAAGCAAGGGCGATTTCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4063 |
C. elegans |
cul-3(gk5137[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5552 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGATATTCTGATGTATATGGATCGGATCTA. Right flanking sequence: CTTCATGCCGTCACCAATCATCATCAAGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4064 |
C. elegans |
ceh-54(gk5138[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 3125 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTATTCTGGAAATCGGCAAAAAACCAGTT ; Right flanking sequence: GTATAGATAATGCGCTTATTCAAAGTGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4065 |
C. elegans |
ampd-1(gk5139[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5156 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAAAAGTCTGATGAAGATTCTGAGCCACCA. Right flanking sequence: TACCAATGTTCCAGATATTCGTGTCAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4067 |
C. elegans |
cus-2(gk5141[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 4196 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGAATCTCAAAAAATCGATGAAATCCATGA ; Right flanking sequence: CGGCGTCGTATCGGTAACCTTTCCAACGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4069 |
C. elegans |
aps-1(gk5143[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 738 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CATGATGCAATACATGCTTCTCTTCAGTCG. Right flanking sequence: TTGGGATAATGAAGATAATAGTAACATAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4071 |
C. elegans |
C06A6.4(gk5145[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2765 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATGAAATTTTAGTTAACATTGGCCAGTT ; Right flanking sequence: CACGGAACCGTGTCACTCCAATATCTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4073 |
C. elegans |
fezf-1(gk5147[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACTAAAGGCAAATCTGGATATAAACCGCC ; Right flanking sequence: ATCGTATAACCTTGCATTCCACATGTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4074 |
C. elegans |
cdh-9(gk5148[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 4415 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGACTTGTTACATTGAATTCTGAAGGTAGT ; Right flanking sequence: CACCGGGTCCCAAAAGATCACAAGGTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4077 |
C. elegans |
lbp-8(gk5151[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 438 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: ATTAACAACTCAATTAATTCAGTCCTTCCT ; Right flanking sequence: CTGGGAGCGTCATTTGTCGTAGAGAGTTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4078 |
C. elegans |
lbp-6(gk5152[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 924 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGGAATTGAGAATCTATTCGCGAACGTACT ; Right flanking sequence: TCCAACGAATTCTTGAGACATGGTGATGGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4079 |
C. elegans |
lbp-7(gk5153[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 774 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTGAAAACTTGACTTCTGTGGTTTGCAAG ; Right flanking sequence: CGAGTGGGAGAGAGAATAATTTATTTTTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4082 |
C. elegans |
cyn-13(gk5156[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 889 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATCCTTCATAACCGAATCCTCGTTCTCCT ; Right flanking sequence: GGGATTTCTGAGCAGTTTGCAGGTGGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4096 |
C. elegans |
eef-1A.2(gk5157[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1624 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCAGCCTAAAACATATTTAAGCCTCCC ; Right flanking sequence: GATCATCCGGAAAGGTCACCAAGTCCGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4098 |
C. elegans |
hrpk-1(gk5045[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I. Show Description
Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4099 |
C. elegans |
C29E4.12(gk5046[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Homozygous lethal deletion balanced by qC1. Deletion of 304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGTACATTTTCAAAATTAAAGTATGGCCT ; Right flanking sequence: TGGCGAGAAGAGTGTTGAAGAGGCTGCTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4100 |
C. elegans |
lron-9(gk5062[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I. Show Description
Homozygous lethal deletion balanced by tmC18. Heterozygotes are WT with pharyngeal GFP, and segregate GFP heterozygotes, GFP gk5062 homozygotes (arrest stage undetermined), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+ to maintain. Deletion of 2039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTGTCGTATTTTTGTTACAGTACCTACG ; Right flanking sequence: GGTGGTTGGAAGATTCCATCAGCACGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4101 |
C. elegans |
lron-2(gk5159[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2328 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTAAAAAGAAACGCTTTGATTTACCTAGA. Right flanking sequence: GAAGGATTGTGAAACTTTGGAAGGCATTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4102 |
C. elegans |
C49H3.4(gk5160[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1088 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CCGTGGCCGAAAAAAATCCAGAACTTATCG. Right flanking sequence: TTCGGTGGAAAGAAGGTGGAAATTGGCCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4104 |
C. elegans |
AC8.1(gk5162[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 7222 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTCCTAGAATCGACCGCTTTCAGTGTATT ; Right flanking sequence: TGGGCCCAGTTTTCGGACGGTGGTTTTGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4106 |
C. elegans |
fkh-6(gk5164[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAAATTTCACAACTAACTAGTAAGGACTC ; Right flanking sequence: TGACTGGAAAGAGCTCTTTTATTTTCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4109 |
C. elegans |
syg-1(gk5167[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGATTTTAAGAATACTTTCTTTTCCATAT ; Right flanking sequence: CACGGTTTCTTGAGAGATTTCTGGTTTTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4110 |
C. elegans |
gsa-1(gk5168[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2926 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGATCCGATTGCGAACGTTCGATCCCCAAC. Right flanking sequence: CAAAGTCGACGTTGTGCGACAGAACAACTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4128 |
C. elegans |
irk-2(gk5210[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2391 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTACCTGCAACCGAACATGCGCTTCCGCCA ; Right flanking sequence: TCCGTTGAGCTGTGAAAATATCAGTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4131 |
C. elegans |
natb-1(gk5213[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 560 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTCAGGATCGCGAGAAAGCGACTTCCGCAT. Right flanking sequence: CGTCGAATGGCCGGAGAGTTGTCATTTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4137 |
C. elegans |
ptr-9(gk5220[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2787 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATAATATCAAGTCGTGTATTTGTAGCTGC ; Right flanking sequence: GATGTCTGAAAATGTTTTAAATAATTCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4139 |
C. elegans |
ptr-22(gk5222[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 4054 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCAAAAACGGCGGAAAAAATGGAGATGAGG ; Right flanking sequence: ATACTGGAGTAGTCGAAAGTACACCATTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4141 |
C. elegans |
nipa-1(gk5224[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 3485 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAAAAAAGAACAAAAACTGGGTGAGGATC ; Right flanking sequence: ATACCCATAACCGCCTTCCGATGCCCGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4143 |
C. elegans |
ptr-21(gk5226[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3539 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCATCGGATCAAGTATTTGGAAGAAGCAC ; Right flanking sequence: CTCAGTTGGCCTAGCGACCGCTTCGATTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4144 |
C. elegans |
C50D2.2(gk5227[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAACGTGTATTTCGTCTGAAAAACTTGCCG ; Right flanking sequence: GGAGGAAAACTTCGATTCAGCATTCCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4147 |
C. elegans |
F23F1.6(gk5230[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1753 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCATGAAGACATTGATGAGTAGACCAAGG ; Right flanking sequence: TCAAATGTCTTTTTACGAAACAAGACATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4148 |
C. elegans |
ptr-20(gk5231[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3301 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGAAGCACTCGGTGAAGTTTCGCAGGCTCA. Right flanking sequence: TCGTACTAATGTCCCTTCTAGTGTTGGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4151 |
C. elegans |
ptr-15(gk5234[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2870 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATGAGAGTGCATACGACCCAGAATACAAT. Right flanking sequence: CCTCGGTTCGCATATTCAGAATACCGAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4152 |
C. elegans |
gex-3(gk5235[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
[NOTE: Please see RG5044 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2546 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTCGACGTTCGAATATGTACAAGAAAAGTC. Right flanking sequence: TGCTTCATCTGGTCATATGGTTTGGAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4155 |
C. elegans |
gbh-2(gk5238[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1500 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGCTTGTATCAGGTTTCACATGGGTTACCG ; Right flanking sequence: CAGGGAAGTCACAAACTTCTTTATGAATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4159 |
C. elegans |
lbp-9(gk5245[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 406 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGAGAAACATGCCAATTCAAACCGATCTT ; Right flanking sequence: ACGGAGTCAAGTGCACTCGCGTCTACGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4160 |
C. elegans |
ptr-13(gk5246[loxP + myo-2::GFPp::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 3626 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACGGGTACGACGAACAATGGGGCCATGC ; Right flanking sequence: TGACGGCAGGCAGACAGGCAGAACATGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4162 |
C. elegans |
smg-4(gk5248[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CGTTTTGGATGATTGGACGTAGTTGCACGA. Right flanking sequence: GCAGGATGAAAATAGGTTCCAATGACTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4163 |
C. elegans |
Y53F4B.12(gk5249[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 3837 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTCTTCATTATTCTACCCTTCTCACTAAC ; Right flanking sequence: GGTCTACCTTCAACACTACTACCCGGAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. [NOTE: The correct genotype of this strain is Y53F4B.12(gk5249). The strain was incorrectly identified as Y53F4B.13 when this strain was sent to the CGC.]
|
|
| VC4164 |
C. elegans |
mab-20(gk5250[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACTGAGAATTGGGAGACACCGGCTCCAGAC ; Right flanking sequence: TAAAATTAAACGTCGGATCCACAACACAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4167 |
C. elegans |
C56C10.9(gk5253[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 855 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTCCAACTTACATCGTTCACTTCCTTCG ; Right flanking sequence: GATGGGTCGAGATTGTGGGAAAATATCATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4168 |
C. elegans |
ZK1251.3(gk5254[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 708 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGACTTTGTCAAACACGGAAAAACCATTA ; Right flanking sequence: GTTTGGTAGAGGAGAAAGAGTTCCATTAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4170 |
C. elegans |
F52H2.7(gk5256[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 3426 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TACCTGTATGACAAGGAGACGAACTAAAAC ; Right flanking sequence: TCTGGAAATGTAGATAATTATTCTTCGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4171 |
C. elegans |
lgc-33(gk5257[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGTACTACCACTCGGCGGTGAGGCCCGCCG ; Right flanking sequence: CTCTAATGGATCTCTGGTTGTGTGCCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4174 |
C. elegans |
gkDf69[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] V. Show Description
Homozygous viable. Deletion of 7975 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCCAGTCTGATTATCAATTGAAACCTTTG ; Right flanking sequence: CAAAGGTTTCAATTGATAATCAGACTGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC418 |
C. elegans |
him-3(gk149) IV/nT1 [qIs51] (IV;V). Show Description
ZK381.1. Homozygous viable deletion balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and non-GFP gk149 homozygotes (strongly Him, with small broods and many arrested embryos). nT1[qIs51] homozygotes inviable. Pick GFP WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC4183 |
C. elegans |
M03D4.4(gk5269[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2613 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGTTGAGGTGAAGCTCCAGAAGAACTCG ; Right flanking sequence: GGTGGTCTCGCTCGCGCAACGACATGGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4187 |
C. elegans |
ubc-8(gk5273[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2800 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGGAAAAAATACAAAAAAATCCTGAATTT ; Right flanking sequence: AGATACGGTAGACTACTGTAACCCGGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|