More Fields
Strain Species Genotype
BN580 C. elegans f="/strain/search?st1=baf-1&sf1=all">baf-1(f="/strain/search?st1=bq12&sf1=all">bq12[f="/strain/search?st1=g&sf1=all">g>f>p::f="/strain/search?st1=baf-1&sf1=all">baf-1]) III. Show Description
GFP cassette for labeling and FLP-mediated inactivation of baf-1 inserted by CRISPR/Cas9 after the baf-1 start codon. ">" symbols in genotype indicate Frt sites in introns 2 and 3 of GFP.
BT12 C. elegans him-4(rh319) X. Show Description
Him. Reference: Vogel BE, Hedgecock EM. (2001) Development. 128:883-94.
CB112 C. elegans unc-20(e112) X. Show Description
Temperature sensitive. At 15C, L1 larvae are coilers, adults are wild-type. At 25C, severe kinker, some coiling.
CB312 C. elegans unc-13(e312) I. Show Description
Slightly Unc. Suppressed by sup-5 and sup-7. Null allele?
CB4104 C. elegans mab-12(e2166) IV; him-5(e1490) V. Show Description
Males have abnormal swollen bursa. Hermaphrodites have abnormal swollen vulva.
CB5330 C. elegans vab-12(dx25) III; him-8(e1489) IV. Show Description
Vab XX hermaphrodites and XO males, viable at all temperatures. Adult hermaphrodite tail spike is invariably shortened and/or vacuolated, often also abnormal in larvae. Possible excretory cell abnormalities. Rays of adult male tail variably abnormal, other structures normal; males can mate.
CHS1143 C. elegans srab-12(yum1836) V; srab-14(yum1837) II; srab-16(yum1838) srab-17(yum1839) srab-18(yum1840) srab-24(yum1841) srab-25(yum1842) srab-26(yum1843) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1269 C. elegans srb-1(yum2701) srb-2(yum2702) srb-3(yum2703) srb-5(yum2704) srb-12(yum2705) srb-13(yum2706) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
GG5 C. elegans emb-12(g5) I. Show Description
ts. Maintain at 15C. (Some growth at 20C and 25.4C. 72% Emb at 25.6C and 25.8C)
HS1294 C. elegans unc-76(e911) V; osEx225. Show Description
osEx225 [scm::dsh-2::venus + unc-76(+)]. Pick non-Unc to maintain. Reference: Mizumoto K, Sawa H. Dev Cell. 2007 Feb;12(2):287-99.
HS1359 C. elegans unc-76(e911) V; osEx233. Show Description
osEx233 [scm::mig-5::venus + unc-76(+)]. Pick non-Unc to maintain. Reference: Mizumoto K, Sawa H. Dev Cell. 2007 Feb;12(2):287-99.
MQD753 C. elegans hqIs180. Show Description
hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About four mitoflash events per anterior pharynx per 200 seconds on adult days 2-3 when cultured on standard NGM plates at 20C. In hqIs180 mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.
MQD774 C. elegans daf-2(e1370) III; hqIs180. Show Description
hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About two mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.
MQD812 C. elegans daf-16(mu86) I; daf-2(e1370) III; hqIs180. Show Description
hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About three mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.
MQD911 C. elegans hsf-1(sy441) I; hqIs180. Show Description
hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About six mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.
MT3970 C. elegans mab-5(mu14) ced-9(n1653) III. Show Description
Temperature sensitive. About 50% HSN missing. Mab confirmed by Hillel Schwartz 12/5/00. Rec'd new stock from Horvitz lab 12/2000. [NOTE: The genotype of this strain was incorrectly described as carrying mab-5(mu114); however, the actual allele is mab-5(mu14).]
OC100 C. elegans zyg-1(it25) II; sun-1(bs12) szy-18(b53) V. Show Description
bs12 and bs53 partially suppress zyg-1. Grow at 20C.
OC235 C. elegans sun-1(bs12) unc-76(e911) V. Show Description
Unc. bs12 mutation causes sublethal defect in attachment of centrosome to the nucleus in early embryos. Viable 15-25 C. Reference: Kemp et al. (2007) Genetics 176:95-113.
OD178 C. elegans unc-119(ed3) III; ltIs105. Show Description
ltIs105 [(pAA280) pie-1p::GFP::LAP::MVB-12 + unc-119(+)].
OH15288 C. elegans pha-1(e2123) III; otEx7119. Show Description
otEx7119 [inx-10a(fosmid WRM0628bH12):SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
PB212 C. remanei Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from the Wright State University Biology Preserve, Dayton Ohio. Species ID confirmed by mating test with EM464.
RB2176 C. elegans gly-4(ok2943) V. Show Description
Y116F11B.12. Homozygous. Outer Left Sequence: TGACACCAGATTTGACGGAA. Outer Right Sequence: CAAAAACCTCCGAAGCACAT. Inner Left Sequence: AAATTTTGCTTTTTGGGCCT. Inner Right Sequence: CCAAATTTTGCGACTTACTATCG. Inner Primer PCR Length: 1177 bp. Deletion Size: 617 bp. Deletion left flank: ATCATCACGGCACAATGAGAAAAGTTGCTC. Deletion right flank: ATTAGATGTCGATAGTAAGTCGCAAAATTT. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2624 C. elegans Y105C5B.12(ok3675) IV. Show Description
Y105C5B.12 Homozygous. Outer Left Sequence: cattgtgtccaaagtgtccg. Outer Right Sequence: ctgatttctggctctacggg. Inner Left Sequence: gcggttggttcataaattgg. Inner Right Sequence: ggtgagatcacctcgaaagc. Inner Primer PCR Length: 1118. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB512 C. elegans D2030.5(ok243) I. Show Description
D2030.5 Homozygous. Outer Left Sequence: gcttcaacttccactgctcc. Outer Right Sequence: tctcaagcacattggtctcg. Inner Left Sequence: ccaagtagccttcatctcgc. Inner Right Sequence: cccatgtgcgtaaggaattt. Inner Length: 3121. Estimated Deletion Size: 1621. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB712 C. elegans daf-18(ok480) IV. Show Description
T07A9.6. Homozygous. Outer Left Sequence: CCTCCGACTGCTCCAGTAAC. Outer Right Sequence: AAGGAATGGCTTGAAGCAGA. Inner Left Sequence: CAGCAAAGGAATTGTCCGAT. Inner Right Sequence: CCCACGACAAATTCTCGACT. Inner primer WT PCR product: 3002. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB812 C. elegans fax-1(ok624) X. Show Description
F56E3.4. Homozygous. Outer Left Sequence: TAGTGCACGGACTAGGGCTT. Outer Right Sequence: AGATTGAGCACCACCAAACC. Inner Left Sequence: GGAAGCCCTAGCGAGAAGAT. Inner Right Sequence: CTTGAAGTGGCACGAGTCAA. Inner primer WT PCR product: 2430. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB912 C. elegans ddx-19(ok783) II. Show Description
T07D4.4a. Homozygous. Outer Left Sequence: CCAGTAATGCTCCACCACCT. Outer Right Sequence: CGTGTGACAGAAAATGACGG. Inner Left Sequence: GGAGTTTTAGCCCCGAGAAC. Inner Right Sequence: CGACAGCGAGTCCACTGTAA. Inner Primer WT PCR product: 3113. Deletion size: 1107 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3107 C. elegans rpb-12(ve607[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 437 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve607 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gaagatcaagtatgaaatttaaaattcaac ; Right flanking sequence: ttgttaatgaaatgcgaaacgataaatttt. rpb-12 sgRNA #1: ggctgaacctgtatcatttt; rpb-12 sgRNA #2: ttaaagatattcagaATGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3230 C. elegans gly-5(gk3119) III. Show Description
Y39E4B.12. External left primer: GAAAAGGCAAAATACGACAAGG. External right primer: AATCGCGAAAAATTTCCAGTAA. Internal left primer: CAAAAATGTTGTCGATTTACGAAG. Internal right primer: CTTTTCTTACCAAGCATCGAATTT. Internal WT amplicon: 1049 bp. Deletion size: 233 bp. Deletion left flank: AGCGTGAGGGATTGATTCGAGCAAGACTTC. Deletion right flank: AATTTTGTGTCAAAAAATGGAAGGTAAAAA. Validation: gk3119 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3317 C. elegans +/II; gly-5(gk3278)/mT1 [dpy-10(e128)] III. Show Description
Apparent homozygous lethal deletion chromosome (gk3278 in Y39E4B.12) balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk3278 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAAAGGCAAAATACGACAAGG. External right primer: AATCGCGAAAAATTTCCAGTAA. Internal left primer: CAAAAATGTTGTCGATTTACGAAG. Internal right primer: CTTTTCTTACCAAGCATCGAATTT. Internal WT amplicon: 1049 bp. Deletion size: 581 bp. Deletion left flank: TCTGTACAAAAAAGCATTTTTTCTGCAAAA. Deletion right flank: AATGGAAGGTAAAAATTAAATTTTCGACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4163 C. elegans Y53F4B.12(gk5249[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 3837 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTCTTCATTATTCTACCCTTCTCACTAAC ; Right flanking sequence: GGTCTACCTTCAACACTACTACCCGGAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. [NOTE: The correct genotype of this strain is Y53F4B.12(gk5249). The strain was incorrectly identified as Y53F4B.13 when this strain was sent to the CGC.]
VC4549 C. elegans glb-12(gk5620[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAGTTGACTTTTTTTGAATCCTCTTACCGA. Right flanking sequence: CTTGGAAATCAAATAAATCCTAACTGAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC935 C. elegans gly-5(gk383) III. Show Description
Y39E4B.12a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC993 C. elegans gly-5(gk406) III. Show Description
Y39E4B.12a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807