Search Strains

syIs33 [gpa-1::GFP]. Labels the spicule neurons in males.

syIs20 [gpa-1::lacZ + dpy-20(+)] V. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.

syIs20 [gpa-1::lacZ + dpy-20(+)] V. Unc. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.

syIs46 [dpy-30::S65T::lacI + hsp-16p::GFP::lacI + dpy-20(+)] II. Animals are Ncl, Him and Non-Dpy. Heat shock results in diffuse nuclear GFP expression from Fire Lab vector pPD49.78::LacI in most cells. Also see some consitutive GFP expression in embryos from dpy-30 promoter. Do not distribute this strain; other labs should request it from the CGC.

Hermaphrodites are WT. Males are defective in response and vulva location mating behaviors. Low mating efficiency with non-Unc hermaphrodites. Do not distribute this strain; other labs should request it from the CGC.

syIs20 [gpa-1::lacZ + dpy-20(+)] V. Dpy. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.

Double mutant phenotype resembles that of the single mutants. Do not distribute this strain; other labs should request it from the CGC.

Hermaphrodites are WT. Males are defective in response and vulva location mating behaviors. Low mating efficiency with non-Unc hermaphrodites. Do not distribute this strain; other labs should request it from the CGC.

Do not distribute this strain; other labs should request it from the CGC.

syEx468 [myo-3p::egl-19::GFP]. C-terminal GFP fusion. Pick GFP+ to maintain.

syEx470 [myo-3::unc-38::GFP]. Pick GFP+ to maintain. unc-38::GFP transgene produced by in vivo recombination between pR29 (myo-3p::unc-38) and pR26 (unc-38::GFP).

syEx475 [myo-3p::unc-68(see following comments) + myo-2p::GFP + pUC-19]. Pick GFP+ animals to maintain. myo-3p::unc-68 transgene was produced by injecting pEM23 (myo-3 promoter + unc-68 exons 1-8) + 18 kb unc-86 PCR fragment (start codon through nucleotide 18090) + pLM511 (unc-68 position 11989 to the end); fragments were recombined in vivo.

Him.

Semi-dominant. 60% of adult males will have protruding spicules; Prc (protraction constitutive) phenotype. Larval animals and adult hermaphrodites do not display any gross abnormal phenotypes. Prc males have a mating efficiency of 0. Non-Prc males have a mating efficiency of 3. Do not distribute this strain; other labs should request it from the CGC.

Males mate better as heterozygotes.

Brood size 13.5 Brood size may increase after many passages. Do not distribute this strain; other labs should request it from the CGC.

Enhances vulval development in the presence of let-23(sa62gf) in hermaphrodites and males. Animals are Dpy. Hermaphrodites are Egl. Males have abnormal ray development. Do not distribute this strain; other labs should request it from the CGC.

syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Not sure if unc-119(ed4) from the parent strain is still present. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are weak Muv and segregate weak Muv, Muv Twitchers, and Dpy Vuls whose progeny are larval lethal. sy100 is a dominant negative allele of let-60. n1046 is a gain-of-function allele of let-60. Do not distribute this strain; other labs should request it from the CGC.

syEx684 [unc-119(+) + fos-1a/b::GFP-TL]. Ex line of functional fos-1 gene tagged with GFP at the C-terminus. Pick WT to maintain. Throws males. Do not distribute this strain; other labs should request it from the CGC.

syIs187 [pes-10::7XTCF-mCherry-let-858(3'UTR) + unc-119(+)]. Cherry POPTOP. POPTOP expression is best visualized using the mCherry/Texas Red filter. POPTOP transgenes display background expression. POPFOP(sy974) is the control plasmid with mutated binding sites. Analysis of POPFOP should always be used to subtract background expression. Do not distribute this strain; other labs should request it from the CGC.

syIs202 [vang-1::YFP + myo-2::DsRed + unc-119(+)]; outcrossing suggests array is integrated in LG V. Reference: Green JL, et al. Cell. 2008 Aug 22;134(4):646-56.

syIs197 [hs::LIN-3c(cDNA) + myo-2p::DsRed + pha-1(+)]. Him. Maintain at 15C. To induce LIN-3/EGF expression, heat shock at 33C for 30min (water bath) and let animals recover at least 1hr from the behavioral effects of the heat shock. Heat shock-induced LIN-3 should inhibit feeding, locomotion and sensory responses for several hours. For details on EGF-induced quiescence, see Nature Neuroscience 10, 1300 - 1307 (2007). PS5970 is identical to PS5628 as described in Development 137, 2065-2074 (2010) except that it has been outcrossed to remove accumulating suppressors.

syEx1147 [des-2::DES-2::GFP + pha-1(+) + pBluescript KS(+)]. Maintain at 25C to select for presence of transgene. GFP reporter is driven by the promoter of the des-2/des-3 operon and is expressed in ALA, RID, PVD, FLP, IL2, PLM, PVC, and M1 muscles of the pharynx. This construct contains 3.4 kb of sequence upstream of the des-2 start ATG (Treinin et al., 1998) (Van Buskirk and Sternberg, 2010).

Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Body is slightly shorter. Do not distribute this strain; other labs should request it from the CGC.

syEx1341 [ges-1p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in the intestine. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in the intestine. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1342 [myo-2p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + unc-122p::mCherry::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in the pharynx. Maintain at 25C and pick animals with red fluorescence in coelomocytes. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in pharyngeal muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1343 [myo-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in body wall muscle. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in body wall muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1344 [rab-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed + pha-1(+) + pBluescript]. GFP expression in neurons. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in neurons. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of seb-3 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATTGAAAAAACTGGAAAACAGTTCGTATAATCCG right flanking sequence: GGgtgggtcaagttccagtgttcagtttttttaaag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAGTTCGTATAATCCGGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of str-74 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGGAATATTGTTTTCGGGAATAGAAATCCTTGC right flanking sequence: CAGACCATTCGCTCATAATTATAACAACAGTTTGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATGAGCGAATGGTCTGGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-49 into parental strain CB4088. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTGCTTTTGGCTGTTTTCTGCATTGCTGCCTAT. Right flanking sequence: CCTGGGCTGATGGGgtatgttccaatattgaacc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTGCATTGCTGCCTATGCCT Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Lineage defects in B, F & U blast cells resulting in abnormal spicules and ectopic spicule cells. F34D10.5 rescues lin-48(sy234); it encodes a C2H2 zinc finger protein similar to Drosophila ovo. Do not distribute this strain; other labs should request it from the CGC.

Him.

Spermatogenesis abnormal with small brood size. PKD-2::GFP ciliary localization defective. Maintain at 20 C. inpp-5K formerly known as cil-1. Reference: Bae Y, et al. 2009 Curr Bio 19(19):1599-607.

Defective in male sex drive regulation. Reference: Nat Neurosci. 2012 Dec;15(12):1675-82.

myEx741 [pdfr-1p(3kb)::NLS::RFP + unc-122::GFP]. Him. Pick RFP+ and GFP+ to maintain. Reference: Barrios A, et al. Nat Neurosci. 2012 Dec;15(12):1675-82.

cil-7(tm5848) is an out-of-frame deletion. Him. Reference: Maguire JE, et al. Mol Biol Cell. 2015 Aug 1;26(15):2823-32. doi: 10.1091/mbc.E15-01-0009. Epub 2015 Jun 3. PMID: 26041936.

cil-7(tm5848) is an out-of-frame deletion. Him. Reference: Maguire JE, et al. Mol Biol Cell. 2015 Aug 1;26(15):2823-32. doi: 10.1091/mbc.E15-01-0009. Epub 2015 Jun 3. PMID: 26041936.

mNeonGreen tag inserted into endogenous nekl-4 locus by CRISPR/Cas9 engineering. Very faint mNeonGreen expression in the dendrites, soma, and axons of all ciliated neurons. Reference: Power KM, et al. PLoS Genet. 2020 Oct 16;16(10):e1009052. PMID: 33064774

myIs4 [pkd-2p::pkd-2::GFP + unc-122p::GFP]. Phenotypically normal. sid-2::mScarlet is functional in environmental RNAi. Reference: Nikonorova IA, et al. Curr Biol. 2022 Mar 19;S0960-9822(22)00396-7. PMID: 35334227

Males Lov and response defective. Mislocalizes pkd-2::GFP in cilia. sy511 contains a nonsense mutation in exon 10 (C-T transition = Q706stop).

Superficially WT.

Superficially WT.

Males are response and location-of-vulva defective. pkd-2(sy606) is a 2396 bp deletion (8388 to 5942 in YAC Y73F8A); mutant protein is predicted to contain the N-terminal portion of the protein midway through the first predicted transmembrane region.

Male mating response defect.

fxDf1 (II: 2,484,339 - 2,487,244) removes nspf-1, nspf-2, and nspf-3. Him. This strain carries a knockout of the Nematode-Specific Peptide family, group F (NSPF) gene family, which localizes to sperm membranous organelles. There are no effects on spermatogenesis, male fertility, or sperm competitive ability. Hermaphrodites produce approximately 30% males. Reference: Kasimatis KR, et al. (2018) BioRxiv 290221; doi: https://doi.org/10.1101/290221.

fxIs1 [pie-1p::TIR1::mRuby, I:2851009] I. Auxin-inducible spermatogenesis arrest, resulting in hermaphrodite self-sterility and reversible male sterility. Him: males produced at ~30%. AID* tag was inserted into the endogenous spe-44 locus. Reference: Kasimatis KR, et al. (2018) Auxin-Mediated Sterility Induction System for Longevity and Mating Studies in Caenorhabditis elegans. BioRvix. doi: https://doi.org/10.1101/284232.

rdIs26 [R08E3.4::GFP + unc-119(+)]. Construct contains ~5 kb upstream of R08E3.4A. Superficially wild-type. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.