Search Strains

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F09B12.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gaactaaaaattgcagATGAAACGTGTGCCGACG. Right flanking sequence: GTCAATTTCGATGTAGCAATGGAAGGTGTATAACG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCTACATCGAAATTGACCGT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAACCTTCGTGTACTCAAGTGATGACGCGCTGGCAG. Right flanking sequence: GGATGGTAGTTTCAATGgtaagtcaataaaatttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATGACGCGCTGGCAGGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of srg-36. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAGTCTACGGAGCAGCACTACTAGTTCTGTACACCT. Right flanking sequence: ATGTGGTCATCATCATCATTGCACATAAAAAGTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTAGTTCTGTACACCTATG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C28G1.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGGTTTGTGCATCAAAACTATTCGAAAACCCCGA. Right flanking sequence: AGTGAAATGTCCAACTTGTCGTCAGCCAATTGAGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGTTGGACATTTCACTTCG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F09G2.8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACACTCGAATAGAAGTTCCAACGAGTAAAAACAG. Right flanking sequence: CGGTGGTGACGGAATGCACAGTCCGTATTACGACG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCAACGAGTAAAAACAGCGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F11E6.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATATTTTTTTGTTTCTCTTCTTAAGAAATATCCTCAT. Right flanking sequence: ATTCTACCGTTTCTTGCGTCCCGTGATGCATCAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCAAGAAACGGTAGAATATG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C44H4.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctttttttcagATTCACAAAAAACTTGAAGCCCGAGC. Right flanking sequence: AGATATCCTTAGACGTGTTAAAAGGAAATAGTAAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACGTCTAAGGATATCTGCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of trap-4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCGCCAAAGTACTCGGCCTCGTCATTCTCCACTAC. Right flanking sequence: CGACGGATTCTTCCACTACAAAACCACCTTCATC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCGTCATTCTCCACTACCGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of rab-39. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTACCAATATCGTCTTATCGTTATTGGGGATTCAAC. Right flanking sequence: AGTTGGCAAATCTAGTCTTTTACGGTACTTCACAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATTGGGGATTCAACAGT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of cyn-11. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGATAACCCAATCGTTTTTCTAGAAGTTACCGC. Right flanking sequence: CGGTGGTGCACCAATCGGAACTATTGTTgtaagttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTAGAAGTTACCGCCGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of lim-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ccacttttcagTCAAAAGAAGAAATCCTCCAAGT. Right flanking sequence: GAATTCGGCGTCTCGACCAGCACTGCCACGTCAGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTCGAGACGCCGAATTCACT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F16F9.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACCATCATATAGCCCTCGCCGCCCTCCTCCACCA. Right flanking sequence: TACGAAGAGCAGAACAATCGAAATGCAAAAAAGgtg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTTCTGCTCTTCGTATGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of imph-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAACTACAGGCCGTTCAACAGCAACAAGCCCAAC. Right flanking sequence: AGATGCACCATCGTCTTCAAGGAGCTCCGATCAATC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGACGATGGTGCATCTGTT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F26G1.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCCCGAAAATTCGAAACCGACCCGGATTTGGTAA. Right flanking sequence: TTCCGGCCGTTCAACACCCGTTAGAAGACGCAGAAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGACCCGGATTTGGTAATTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of tep-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGTACAAATGCAGCTGTGGTGTCAACAACCGCGG. Right flanking sequence: CGCCAGTTAAgtaagttctgtaaaatattgatgatc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTTACTTAACTGGCGCCG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of dhp-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACCACTTGTTATCAAGAATGGAACTGTCGTCAATGA. Right flanking sequence: AGATGGAATGTTTAAAGCTGATGTTCTTGTTAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAACTGTCGTCAATGAAGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of Y105E8A.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATTCTATTCACTATTATGTGTCATTTACAAGTG. Right flanking sequence: ATTCGGTGACAATAAAAGATCCACCAACACTGGAAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTGTCATTTACAAGTGATT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of itm-2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTGTGCGAGGCTGATGAGGAGAAGCACATCAGTAA. Right flanking sequence: CTGCGGCTGGGTACCAATGGAAGGAGGCAACTTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GAGAAGCACATCAGTAACTG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of sfxn-1.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTCCGCCGATTCTTGCTCGTCTCGTTCCATTT. Right flanking sequence: GCTGCTATTGCATTCGCCAATGCAATTAATATTCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCGAATGCAATAGCAGCAAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F21G4.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAATAACGGATGAATTAAGTACAAATGTATCGTTG. Right flanking sequence: GACAGGGAATTAAACCTTTTGAAATCGGCACAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTACAAATGTATCGTTGGAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F22G12.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: caccaaaacccaaccaatttccagAGAACCTTTCGG. Right flanking sequence: CAATGGATTTCCTGCTCGGCAACGGAGCCGATGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCCAGAGAACCTTTCGGCAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F33E11.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAATGTTCGATATCAGCGATTGGCTCAGGAGTATA. Right flanking sequence: CGAAGgtgcggacgagaaaattttttttttttttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTGGCTCAGGAGTATACGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. Penetrance lethal with lots of unhatched eggs and slow growth. CRISPR/Cas9 engineered STOP-IN null mutant of hint-3 into hint-1(sy1567) stop-in mutant. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: catgttttacaggATGACGTCAATGCATACTTCTGT. Right flanking sequence: TAACGGATGCAAGTTTTGTGACATTGTCAAAAATA. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCAATGCATACTTCTGTTAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Homozygous sterile CRISPR null mutant balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP sy2071 homozygotes (L2 or early arrested sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. CRISPR/Cas9 engineered STOP-IN null mutant of npp-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATCAAAACAAAGGATTGTTTGGTCAGCCAGCC. Right flanking sequence: AATAACAGTGGAACTACTGGCCTTTTCGGGGCGGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAGTTCCACTGTTATTGGC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Males are response and location-of-vulva defective. pkd-2(sy606) is a 2396 bp deletion (8388 to 5942 in YAC Y73F8A); mutant protein is predicted to contain the N-terminal portion of the protein midway through the first predicted transmembrane region.

ytEx100 [mel-47(3245 bp rescuing fragment) + rol-6(su1006)]. Maintain by picking Rollers. Animals which have lost the transgene look wt but are fully penetrant Mel. Mutant embryos arrest with less than 100 cells.

The mdt-15(et14) gain-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. The C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Svensk E, et al. PLoS Genetics 9:e1003801. PMID: 24068966

This double mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093

This triple mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The acs-13(et54) mutation (G125R) can be detected using PCR with the following primers: WT FWD: 5´CTA CCA GGG TGT TCG CCA TG 3; acs-13 mutant FWD: 5´CTA CCA GGG TGT TCG CCA TA 3; acs-13 REV: 5´TCA AAC TTG GGC ATT GCT CC 3´. Annealing 65°C, expected product 395 bp. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093

paqr-1 gain-of-function allele. R109C amino acid substitution isolated in a paqr-2(tm3410) suppressor screen. PCR genotyping can be done with these primers: paqr-1 seq REV: TTTCCGTGTGCAGTGACCA; paqr1_WT_REV: TGCCCTCCCTTTTTACGGCG; paqr1_mut_REV: TGCCCTCCCTTTTTACGGCA. This yields a 441 bp product. Reference: Busayavalasa K, et al. PLoS Genet. 2020 Aug 4;16(8):e1008975. PMID: 32750056

Reference: Ohta H, et al. Genetics. 2008 Oct;180(2):785-96.

tm442 is a 411 bp deletion and 13 bp insertion. Outcrossed to mC6g males. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.

tm1692 is a 656 bp deletion and 13 bp insertion. Outcrossed to mC6g males. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.

rdIs2 [ehn-3a::GFP + rol-6(su1006)] V. Rollers. The ehn-3a::GFP reporter (pRA230) contains 3,003 bp upstream of the ehn-3a translational start and the first two exons of ehn-3a. GFP expression in Z1 and Z4 during embryogenesis and early larval development. Reference: Welchman DP, Mathies LD, Ahringer J. (2007) Dev Biol. 305(1): 347-57.

ZK970.6 Homozygous. Outer Left Sequence: CGGTGTCATTTCAGAGAGCA. Outer Right Sequence: GTTGAGGCAACCTTAAGCGA. Inner Left Sequence: TTGCTCAGCTTTTGGCCTAT. Inner Right Sequence: AGTGCGGATTGTCTGGAAAG. Inner Primer WT PCR Product: 3316. Deletion size: 1545 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01F6.1 Homozygous. Outer Left Sequence: GGTTTTAGGAAACGGCATCA. Outer Right Sequence: AGCGTTACGAATTTTGGCAC. Inner Left Sequence: CTAGCAGGAGTGGTCTTGCC. Inner Right Sequence: GGATCAAAATGGAACATCCG. Inner Primer WT PCR Product: 2438. Deletion size: 1583 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T19D2.1. Homozygous. Outer Left Sequence: GAGGAAATCGCGATGAAGAG. Outer Right Sequence: TCTCCGCAGTTTACAGAGCA. Inner Left Sequence: AGAGTTGGCTGTATTTGCGG. Inner Right Sequence: CGGCACATTCTGAAAGTCAA. Inner Primer WT PCR Product: 3298. Deletion size: 1666 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK455.1. Previously called gei-22. Homozygous. Outer Left Sequence: CACACACAAAAACGGACAGG. Outer Right Sequence: TCGTTGCTCCAAATCACAAA. Inner Left Sequence: AGACGAGCTTCCAATCTCCA. Inner Right Sequence: TTCCTCCGTTGCGGTAATAG. Inner Primer WT PCR product: 2984. Deletion size: 540 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08E3.4. Homozygous. Outer Left Sequence: GGATGGACTCGAACCAAAAA. Outer Right Sequence: TTCTGGAGGGTCTCTGCCTA. Inner Left Sequence: TTGCAGGAAACACAACGAAG. Inner Right Sequence: CAAATTTGCCATATGTTGCG. Inner Primer WT PCR product: 2983. Deletion size: 1146 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02D3.1. Homozygous. Outer Left Sequence: TGTTCAAGCGTAACACGACC. Outer Right Sequence: AAACCATTTGGATTGCCGTA. Inner Left Sequence: CAGATGTCTGCCGCTGTAAC. Inner Right Sequence: TTCAACACAACCAAATCCGA. Inner Primer WT PCR product: 3055. Deletion size: 923 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08B6.4. Homozygous. Outer Left Sequence: AACACAACGAGGGACCTGAC. Outer Right Sequence: TGAACGCATCTGGATCATGT. Inner Left Sequence: GAGTCGGGGAAAAAGGGATA. Inner Right Sequence: GGTCGACCTAATGGAGACCA. Inner Primer WT PCR product: 2177. Deletion size: 1624 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C10.12. Homozygous. Outer Left Sequence: GAGAAAGTGAGCTCCGCAAT. Outer Right Sequence: GCCTACAAAAATGCCATTCG. Inner Left Sequence: ATCACATCGAGGCAAGCTCT. Inner Right Sequence: CAATCGATACAAGCAGCCAA. Inner Primer WT PCR Product: 2693. Deletion size: 635 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07C11.5. Homozygous. Outer Left Sequence: GAACGGCCTATGGTGACACT. Outer Right Sequence: TGAGCAGAACGAAAGGAGGT. Inner Left Sequence: GACAATTGTTTTTGGACGGG. Inner Right Sequence: CCGAGCAAATTTGGAAACAT. Inner Primer WT PCR product: 2642. Deletion size: 1680 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48C3A.14 [Merged Y48C3A.15 in to this gene based on BLASTX homologies.] Homozygous. Outer Left Sequence: GACACCCTTGGTGTTCAGGT. Outer Right Sequence: ATCACTTTTCCTCGGGGAGT. Inner Left Sequence: TTGTGGCGACTCTGATGAAG. Inner Right Sequence: ACGAACATTTGAATTTCCCG. Inner Primer WT PCR Product: 2998. Deletion size: 2275 bp; includes insertion of approximately 1150 bp at break. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK970.6. Homozygous. Outer Left Sequence: CGGTGTCATTTCAGAGAGCA. Outer Right Sequence: GTTGAGGCAACCTTAAGCGA. Inner Left Sequence: TTGCTCAGCTTTTGGCCTAT. Inner Right Sequence: AGTGCGGATTGTCTGGAAAG. Inner Primer WT PCR Product: 3316. Deletion size: 2542 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11C7.4 Homozygous. Outer Left Sequence: TGAATCTTTGCAATTCGTGG. Outer Right Sequence: CTTGGTGTTCAACATGACCG. Inner Left Sequence: ATTGGCAAACGATTTTCTCG. Inner Right Sequence: CAGTCAACGGACAGCTTGAA. Inner Primer WT PCR Product: 3232. Deletion size: 843 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0348.4a Homozygous. Outer Left Sequence: ACATCCGGAGCTAAAGCAGA. Outer Right Sequence: CGCCGAGAAAGCAATAGAAC. Inner Left Sequence: TGCTACCTATTGGGTTTCGG. Inner Right Sequence: TGGCCGAGTTTTCTCATCTC. Inner Primer PCR Length: 2928. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K06B9.5. Homozygous. Outer Left Sequence: GGGCAGAACACGAATTTTTC. Outer Right Sequence: GCACATCCCTGGTTGAAACT. Inner Left Sequence: CGCAAATTTGGTCCTGAAAT. Inner Right Sequence: CTCCGCCTACTGTTAGCTCG. Inner Primer WT PCR product: 2959. Deletion size: 1620 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T09A12.4. Homozygous. Outer Left Sequence: GGTATCTGCCTTGTTCTGCC. Outer Right Sequence: GAAACGATGCTCATGCTCAA. Inner Left Sequence: AACCGCGAACAACGAGTTAC. Inner Right Sequence: CAGGGGAACCGCTAGACATA. Inner Primer WT PCR product: 3091. Deletion size: 1317 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C43E11.6. Homozygous. Outer Left Sequence: ATCGCAATTTTCTCCATTCG. Outer Right Sequence: GCGTACTTCTTTCGGAGTGG. Inner Left Sequence: TATTCCGATTCCACACAGCA. Inner Right Sequence: CGATGCGTCAATTTATGTGG. Inner Primer WT PCR Product: 3254. Deletion size: 1032 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807