| RB1070 |
C. elegans |
mrp-6(ok1027) X. Show Description
F20B6.3 Homozygous. Outer Left Sequence: GTTGCGAACCTAGGCATTGT. Outer Right Sequence: TCGGAAATGGATCTCTGGAC. Inner Left Sequence: TCTGGATGCAAGCATCTGTC. Inner Right Sequence: CGCCACCATCTCCAGTAAAT. Inner Primer PCR Length: 3296. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1071 |
C. elegans |
F14F3.3(ok1028) X. Show Description
F14F3.3 Homozygous. Outer Left Sequence: GGAGCGAGAAAATGGTTTTG. Outer Right Sequence: GCAGTCATCGCATTCCTTTT. Inner Left Sequence: GATGCAAAGGGCGAAAATAA. Inner Right Sequence: TAGTAATGCGTCCGCAAACA. Inner Primer PCR Length: 2829. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1072 |
C. elegans |
sod-2(ok1030) I. Show Description
F10D11.1 Homozygous. Outer Left Sequence: ACTGCTCGACAGACTCCGAT. Outer Right Sequence: GACGCATTCACCAACAAATG. Inner Left Sequence: TCGAGGCTGGAACTTCAACT. Inner Right Sequence: CCCCTAATAACTGCACCGAA. Inner Primer PCR Length: 2320. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1073 |
C. elegans |
dgk-4(ok1031) IV. Show Description
F42A9.1a Homozygous. Outer Left Sequence: CACCAACTCCTGGAGCAACT. Outer Right Sequence: AATCTCATGACTGGGGCAAG. Inner Left Sequence: TGAGCCATCGACTGCTTATG. Inner Right Sequence: CGGCGTTGGTAGTTTTCAGT. Inner Primer PCR Length: 3388. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1074 |
C. elegans |
smf-3(ok1035) IV. Show Description
Y69A2AR.4 Homozygous. Outer Left Sequence: TTCAGCTTGTCAAGGGCTTT. Outer Right Sequence: CTTCCATTGGGGAAGTTTGA. Inner Left Sequence: CCCAAAGTGATCGGAACCTA. Inner Right Sequence: GGGATTATTTGGACCCGACT. Inner Primer PCR Length: 2195. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1075 |
C. elegans |
pes-9(ok1037) V. Show Description
R11H6.1 Homozygous. Outer Left Sequence: CTTCGATGAGACAGCCACAA. Outer Right Sequence: TTACTGGAAGTTTCCCCGTG. Inner Left Sequence: CAACGGCAACAAGATTAGGG. Inner Right Sequence: GTGAAGCAGTGGCAATTCAA. Inner Primer PCR Length: 2301. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1077 |
C. elegans |
rgs-10(ok1039) X. Show Description
F45B8.2 Homozygous. Outer Left Sequence: AAACCACAGGGTCTGACAGG. Outer Right Sequence: CTTGCGCGACATCAAAAGTA. Inner Left Sequence: GGCATGTTCACTCGGAATTT. Inner Right Sequence: CGTTTGTGCAGAGTGAAGGA. Inner Primer PCR Length: 2185. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1078 |
C. elegans |
T10G3.5(ok1040) V. Show Description
T10G3.5 Homozygous. Outer Left Sequence: GCTTCCAATTCTCTTGCTCG. Outer Right Sequence: ATTTAAGCGGAACAGCCTCA. Inner Left Sequence: TGAACTGCGTCTTCAATTCG. Inner Right Sequence: GAAATCAGAGGGAATCCGGT. Inner Primer PCR Length: 2757. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1079 |
C. elegans |
alg-4(ok1041) III. Show Description
ZK757.3 Homozygous. Outer Left Sequence: GGATTTGGTCCGAAGTAGCA. Outer Right Sequence: GCCGATGATCAAGGATCTGT. Inner Left Sequence: GAGTTGGAATGGAGACCGAA. Inner Right Sequence: CAATATGCGTGAGGTGGTTG. Inner Primer PCR Length: 2888. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1080 |
C. elegans |
haf-4(ok1042) I. Show Description
W04C9.1. Homozygous. Outer Left Sequence: AGTCCTTGGGTCTCACAACG. Outer Right Sequence: ACGATTTGTTCCTGCCAATC. Inner Left Sequence: CCGTGAAAAAGTACGCGTTT. Inner Right Sequence: GCACTCTAAACACTTCCGGC. Inner Primer PCR Length: 2570 bp. Deletion Size: 1678 bp. Deletion left flank: ACACGGGACAAGTCATCGCTACCGTGGTCG. Deletion right flank: GCGTCAATTTCGGTTCGACAAATCGTTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1081 |
C. elegans |
klf-2(ok1043) V. Show Description
F53F8.1 Homozygous. Outer Left Sequence: GTTACTGTTTGCCCATGCCT. Outer Right Sequence: CGTCTTGTTCATCCGTTTCA. Inner Left Sequence: GAAATGCCCAAAAGTGTCGT. Inner Right Sequence: CTCGAAAATTTCCTGGAGCA. Inner Primer PCR Length: 3195. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1082 |
C. elegans |
K12G11.2(ok1048) V. Show Description
K12G11.2 Homozygous. Outer Left Sequence: TGTCAGGTGGAATACGACGA. Outer Right Sequence: ACATATTCCGAAAAGTGCCG. Inner Left Sequence: TGTTCCATTCACTTCCGTCA. Inner Right Sequence: TGCACGTACACATTCTGCAA. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1083 |
C. elegans |
F27C8.5(ok1050) IV. Show Description
F27C8.5 Homozygous. Outer Left Sequence: AGATTGCGTCTGTGTGATCG. Outer Right Sequence: CTAGAGAAAGGTGCATCGGC. Inner Left Sequence: CGCGGCTTCACAAATAAAAT. Inner Right Sequence: AGAACCTCTTTTCCGGTGGT. Inner Primer PCR Length: 3168. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1084 |
C. elegans |
oct-1(ok1051) I. Show Description
F52F12.1 Homozygous. Outer Left Sequence: TATCGGAGTGTCGATGCAAG. Outer Right Sequence: CAGCCTACCTTCGTGCCTAC. Inner Left Sequence: GATTCTCGTTTCTTGGCTGC. Inner Right Sequence: GCAAGAGGCAGGCATAGTTC. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1085 |
C. elegans |
tir-1(ok1052) III. Show Description
F13B10.1a Homozygous. Outer Left Sequence: GCAATCAAAGTTTCCAGCGT. Outer Right Sequence: CCTTGTCCTACTCAGCCAGC. Inner Left Sequence: AGATAAAGTCGGCAACCTGC. Inner Right Sequence: CAAATGGCGATCTGTACCCT. Inner Primer PCR Length: 3224. Estimated Deletion Size: about 1900 bp. From Nathalie Pujol 11/04: breakpoints, with a 8 bases insertion, AAATGTCGCCGGATCGTGAACTTGCAAGAAT/AGAATAAA/TGTAGACAGTGCTGGCGT AATTCGCCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1086 |
C. elegans |
inx-5(ok1053) X. Show Description
R09F10.4 Homozygous. Outer Left Sequence: TTGCAAGCATTATTTGCGAG. Outer Right Sequence: ATTCCATTTTCCCATCCTCC. Inner Left Sequence: GGCAGCTTGACACAATTGAA. Inner Right Sequence: TTATTGCCGGTGGTTCTGAT. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1087 |
C. elegans |
kal-1(ok1056) I. Show Description
K03D10.1 Homozygous. Outer Left Sequence: TTTTCCGGAAGATTCCAGTG. Outer Right Sequence: AAAAATGCGGGAATGTTTTG. Inner Left Sequence: GCTGAAAAATCGTGGGAAAA. Inner Right Sequence: CCCATTTTCTTTTGCAGGAA. Inner Primer PCR Length: 2786. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1088 |
C. elegans |
magu-2(ok1059) V. Show Description
C01B7.4 Homozygous. Outer Left Sequence: AAAGACCGGGGAGAGATGAT. Outer Right Sequence: GCATATTCTTTTTGGCGCTC. Inner Left Sequence: TAGCACGCTGTCCATGTAGC. Inner Right Sequence: TTGACTCATACGCCCAATCA. Inner Primer PCR Length: 3137. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1089 |
C. elegans |
hpl-1(ok1060) X. Show Description
K08H2.6 Homozygous. Outer Left Sequence: CCGACATAGGTTTGCACCTT. Outer Right Sequence: CGAAGTGGAATTGGTGGTCT. Inner Left Sequence: CAAGATGCTCCGTTGTTTCA. Inner Right Sequence: GGAGTCGGGAATCAGTCAGA. Inner Primer PCR Length: 2728. Upper breakpoint flanking sequence: TTCGGATTTGAAAGAGTCTGAAAAAGAT. Lower breakpoint flanking sequence: TTGAACTGTAGTCTTTGCTACTTCTT. Deletion Size: 1948 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1090 |
C. elegans |
hpl-2(ok1061) III. Show Description
K01G5.2 Homozygous. Outer Left Sequence: TTTTTACGGGCGAAATTCAG. Outer Right Sequence: AATTCAGTGATGACACGGCA. Inner Left Sequence: AATTTGTCGATGCACCATGA. Inner Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Primer PCR Length: 2358. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1091 |
C. elegans |
Y64G10A.7(ok1062) IV. Show Description
Y64G10A.7 Homozygous. Outer Left Sequence: AAAGACCGGACCACTTTGTG. Outer Right Sequence: AACTCACGTTGGACCGAATC. Inner Left Sequence: GTGCGCACACTTGTTCTTGT. Inner Right Sequence: CGATTGACATGCAATTTTCG. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 2700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1092 |
C. elegans |
E02H1.2(ok1070) II. Show Description
E02H1.2 Homozygous. Outer Left Sequence: TTTTCCAAGGTGGACCAAAG. Outer Right Sequence: CTTTTCTCGACGGCTTCAAC. Inner Left Sequence: TTGCTAGGGAGCATCCAAGT. Inner Right Sequence: CCCAATACAACCAGCAACAA. Inner Primer PCR Length: 2359. Estimated Deletion Size: about 350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1093 |
C. elegans |
C08H9.2(ok1071) II. Show Description
C08H9.2 Homozygous. Outer Left Sequence: CATCTTTTCCTGCAACGACA. Outer Right Sequence: AACATCACTTTCCGTTTGGC. Inner Left Sequence: GGATCTTCTGCTCCTTGACG. Inner Right Sequence: GGACGTCTCATTGGAAAGGA. Inner Primer PCR Length: 3020. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1094 |
C. elegans |
tag-52(ok1072) X. Show Description
C02F12.4 Homozygous. Outer Left Sequence: GCAAATACCACCACCACACA. Outer Right Sequence: TATAAACGACGGGAAAACGC. Inner Left Sequence: AAGCTCACCGCAAACTCAAT. Inner Right Sequence: ACATACAGCACGGCATTTGA. Inner Primer PCR Length: 2998. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1095 |
C. elegans |
chup-1(ok1073) X. Show Description
ZK721.1 Homozygous. Outer Left Sequence: AATTTCAGGCGCTATGAGGA. Outer Right Sequence: CTTGAAATAAAAGCGCGAGG. Inner Left Sequence: TGGGATGTGGTGTACGAAAA. Inner Right Sequence: CAGGAAATGACAGCAGCAAA. Inner Primer PCR Length: 2993. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1096 |
C. elegans |
R06C7.1(ok1074) I. Show Description
R06C7.1 Homozygous. Outer Left Sequence: GCTCCACCAGGAGCTATGAC. Outer Right Sequence: AAATCGAACAAAATTCCCCC. Inner Left Sequence: TGTACATGAAGCCAACCGAA. Inner Right Sequence: CGGTTTGTTTGTAGCCGATT. Inner Primer PCR Length: 2933. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1097 |
C. elegans |
grl-4(ok1076) IV. Show Description
F42C5.7 Homozygous. Outer Left Sequence: AAGCCACGTAACAAAATCCG. Outer Right Sequence: AGTGATCAGAGATGGGCTGG. Inner Left Sequence: TACTGTCCAGGGGAGATTCG. Inner Right Sequence: GGCAATGTCGAGAAGGAAAC. Inner Primer PCR Length: 2926. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1098 |
C. elegans |
hsp-12.6(ok1077) IV. Show Description
F38E11.2 Homozygous. Outer Left Sequence: GTGACGATTCGAGAGCAACA. Outer Right Sequence: CGTGCGAAGATTGAACAGAA. Inner Left Sequence: TTCGAAGCTCAATGAACGAA. Inner Right Sequence: AGCCCAAGATGACAATGGAC. Inner Primer PCR Length: 2303. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1099 |
C. elegans |
F55A12.1(ok1078) I. Show Description
F55A12.1 Homozygous. Outer Left Sequence: GAAAGCCAATAACTCGAGCG. Outer Right Sequence: ACGAACATCAGGAAGAACCG. Inner Left Sequence: GGCAGACTTGCATCCATTTT. Inner Right Sequence: AATTGTTGTTGCCTCGATCC. Inner Primer PCR Length: 2978. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1100 |
C. elegans |
ver-4(ok1079) X. Show Description
F59F3.5 Homozygous. Outer Left Sequence: CCAAAAATGCACATGTACCG. Outer Right Sequence: TGATGAAGAAGCTCCAGCAA. Inner Left Sequence: TCTCCGAGGGGCAATACTAA. Inner Right Sequence: TTCGTTGCAGAACACCAAAA. Inner Primer PCR Length: 2587. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1101 |
C. elegans |
scpl-1(ok1080) I. Show Description
B0379.4 Homozygous. Outer Left Sequence: GAAGAACCGGGAGTCAACTG. Outer Right Sequence: AATTTTGAGGGCAGCTACGA. Inner Left Sequence: TTGAAAATTGGAACGAAGGC. Inner Right Sequence: AAGTATGCGGGAACCACAAC. Inner Primer PCR Length: 2908. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1102 |
C. elegans |
ZK370.3(ok1081) III. Show Description
ZK370.3. Homozygous. Outer Left Sequence: GTGCACAAATTGCTTCGAGA. Outer Right Sequence: CCAACACTCTAGCAGCCACA. Inner Left Sequence: TGGTCCATGCATTGAGTCAT. Inner Right Sequence: TAGAATTCTGCAGGCGATCC. Inner Primer PCR Length: 3308 bp. Deletion Size: 1444 bp. Deletion left flank: GCAGAGCCACAACAAGCGAGTCCATCGAGT. Deletion right flank: AAGAAATTTTGGATAAATGTATTTTTTTTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1103 |
C. elegans |
ceh-18(ok1082) X. Show Description
ZC64.3 Homozygous. Outer Left Sequence: TCGGTCATTTTGGCATGATA. Outer Right Sequence: GCTGACCCCTATTCCCTCAT. Inner Left Sequence: CGATGTTGCGTTCATAGTGG. Inner Right Sequence: CGCCCAAAATTTTTCATCAT. Inner Primer PCR Length: 3110. Estimated Deletion Size: about 2100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1104 |
C. elegans |
hsp-3(ok1083) X. Show Description
C15H9.6 Homozygous. Outer Left Sequence: GGGGTAGGAGAGCCATTTTC. Outer Right Sequence: ACTTGGCCTTTTCCGATTTT. Inner Left Sequence: CGATCGTTTAGAGCTCGTCC. Inner Right Sequence: CCTGCCGTTTCCATAACAGT. Inner Primer PCR Length: 2947. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1105 |
C. elegans |
brp-1(ok1084) III. Show Description
Y79H2A.1 Homozygous. Outer Left Sequence: TTGTGCGCATTGATCTCTTC. Outer Right Sequence: GTATCAGAAACCTCAGCGGC. Inner Left Sequence: CAGCTGATTTCGCATGGTTA. Inner Right Sequence: GAATGCAGTGTTGATGGGTG. Inner Primer PCR Length: 3016. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1106 |
C. elegans |
ape-1(ok1085) V. Show Description
F46F3.4 Homozygous. Outer Left Sequence: CAAACAATTGAAATGTGCGG. Outer Right Sequence: GGATTTCGAAAAATGGGGAT. Inner Left Sequence: CAAAAGCTCCAATTCGCTTC. Inner Right Sequence: AGCGTCTTCGTCTGATTGGT. Inner Primer PCR Length: 2748. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1107 |
C. elegans |
haf-3(ok1086) V. Show Description
F57A10.3. Homozygous. Outer Left Sequence: TTTCGGAAATTTTATTGCGG. Outer Right Sequence: CCGTGCATTGATCACTTGTT. Inner Left Sequence: TTTGCATTCCTTCCAAATCC. Inner Right Sequence: TTGAAAACCCTCCTCGTGTC. Inner Primer PCR Length: 2930 bp. Deletion Size: 1150 bp. Deletion left flank: GTGTTTCAGGGAAAAAAATCTACAAAATTT. Deletion right flank: TATTTTTGAAGAAATTTTCTTAATTTTTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1108 |
C. elegans |
pmp-3(ok1087) V. Show Description
C54G10.3 Homozygous. Outer Left Sequence: AAACGATCGAAAAGCAGGAA. Outer Right Sequence: CACCAAAATGCCAGTGTGAC. Inner Left Sequence: ATTTTTGAAATCGTGCCGAG. Inner Right Sequence: GTCGTTCTGAACTAAGGCGG. Inner Primer PCR Length: 3268. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1109 |
C. elegans |
cit-1.1(ok1088) III. Show Description
F44B9.4 Homozygous. Outer Left Sequence: TTTGGAGCTTTGGAGCAGTT. Outer Right Sequence: CTTCACCAAAGAGGAGGTGC. Inner Left Sequence: ATTCTCCACCAGCTCATTCG. Inner Right Sequence: AGCGAGCATTCAAGAAGGAA. Inner Primer PCR Length: 3011. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1110 |
C. elegans |
C17E4.9(ok1089) I. Show Description
C17E4.9 Homozygous. Outer Left Sequence: AAAATTTGCCCTCCTTCCAT. Outer Right Sequence: CTCATCCACACCGAAAACCT. Inner Left Sequence: CAAACTTCCCCCTCTTCCTC. Inner Right Sequence: ATGAGAAGAGACCTGCCTCG. Inner Primer PCR Length: 2190. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1111 |
C. elegans |
srp-7(ok1090) V. Show Description
F20D6.4 Homozygous. Outer Left Sequence: ATTCGTTCTTTTGACACCGC. Outer Right Sequence: TTTCATCTTTTTCCGGCATC. Inner Left Sequence: CAACATAACCTTTCGTCGCA. Inner Right Sequence: CCGCAACAGCTACAGTACCA. Inner Primer PCR Length: 2226. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1112 |
C. elegans |
C45B2.6(ok1098) X. Show Description
C45B2.6 Homozygous. Outer Left Sequence: ACACAGTCCGACAAAACGTG. Outer Right Sequence: GTTTTCCCCGAAAAGGTTGT. Inner Left Sequence: TACGCGGATGCTCAACATAA. Inner Right Sequence: GAAAGGCACCGGTGATTAAA. Inner Primer PCR Length: 3227. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1113 |
C. elegans |
H25P06.4(ok1099) I. Show Description
H25P06.4 Homozygous. Outer Left Sequence: gcgatccaatattagccgaa. Outer Right Sequence: aggttatgctttgtggtcgg. Inner Left Sequence: aatctctcagggctcaacga. Inner Right Sequence: gattatgagcgtggccattt. Inner Primer PCR Length: 2971. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1114 |
C. elegans |
F35C5.12(ok1103) II. Show Description
F35C5.12 Homozygous. Outer Left Sequence: aagctccacgtgcattctct. Outer Right Sequence: gacagccacgtgctttgata. Inner Left Sequence: aaagtcgatggacaagtcgg. Inner Right Sequence: tgaaagcctaccagagcgtt. Inner Primer PCR Length: 2307. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1115 |
C. elegans |
mec-10(ok1104) X. Show Description
F16F9.5 Homozygous. Outer Left Sequence: tcatttgcagcattttctcg. Outer Right Sequence: atttatcaatcaggcggtcg. Inner Left Sequence: gtccaaggtgtcctccaaaa. Inner Right Sequence: tgaagtttgacacaggcgag. Inner Primer PCR Length: 3339. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1116 |
C. elegans |
egl-4(ok1105) IV. Show Description
F55A8.2b Homozygous. Outer Left Sequence: AAAGTTGGTTGTGGACGGAG. Outer Right Sequence: ACTGCACAAAAATTCGAGGC. Inner Left Sequence: AGAACCGCATCAGTTCAAGC. Inner Right Sequence: TTTTGGACGAATTTTGGAGG. Inner Primer PCR Length: 2432. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1117 |
C. elegans |
Y47G6A.14(ok1106) I. Show Description
Y47G6A.14 Homozygous. Outer Left Sequence: aggtgtcaagaagagccgaa. Outer Right Sequence: cctccttgagacttgaagcg. Inner Left Sequence: cttgagcgaggtgtaggctt. Inner Right Sequence: gccaggaagaatttggtgaa. Inner Primer PCR Length: 3237. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1118 |
C. elegans |
ZK370.4(ok1107) III. Show Description
ZK370.4 Homozygous. Outer Left Sequence: ATCAGATCTTCGATCCGGTG. Outer Right Sequence: GTTTGATCCGTCGTGGAAGT. Inner Left Sequence: ATCACTTCAGCTCGGCTCAT. Inner Right Sequence: CGAGTGGAAGCTTGATCCTC. Inner Primer PCR Length: 3173. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1119 |
C. elegans |
ubr-5(ok1108) I. Show Description
F36A2.13 Homozygous. Outer Left Sequence: ctgcctgataccacccactt. Outer Right Sequence: tcttgcaatggttccacatc. Inner Left Sequence: tggaagctcacaagctcaga. Inner Right Sequence: ggaagctcttggagcagatg. Inner Primer PCR Length: 3184. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1120 |
C. elegans |
amt-3(ok1113) II. Show Description
M195.3 Homozygous. Outer Left Sequence: tctggcggctcttcttttta. Outer Right Sequence: tgcactcgggtaacattcag. Inner Left Sequence: cagccaaaccatgttcaatg. Inner Right Sequence: attatggcacaagggagacg. Inner Primer PCR Length: 3116. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|