Search Strains

More Fields
Strain Species Genotype Add
XE2260 C. elegans casy-1(wp78) II. Show Description
wp78 is a CRISPR/Cas9-engineered 11.5 kb deletion removing the entire coding region of casy-1, the C. elegans homolog of calsyntenin. casy-1(wp78) phenocopies the casy-1(wp60) point mutation and strongly suppresses PVQ degeneration in both ric-7(n2657) and miro-1(wy50180); mtx-2(wy50266) mutants. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
XE2795 C. elegans ric-7(wp127[ric-7::gfp11x7]) V. Show Description
wp127 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous ric-7 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: Wu Y, et al. bioRxiv [Preprint]. 2023 Jul 12:2023.07.12.548706. doi: 10.1101/2023.07.12.548706. Update in: J Cell Biol. 2024 May 6;223(5): PMID: 37502914.
XE3354 C. elegans unc-40(wp221) zdIs5 I. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. wp221 is a CRISPR-engineered deletion of unc-40 exon 14.5 near the splice sites of exons 14 and 15. mec-4p::GFP is expressed in touch neurons. Reference: Weinreb A, et al. Nat Commun. 2025 May 16;16:4508. doi: 10.1038/s41467-025-58293-5. PMID: 40379606.
XIL9106 C. elegans bar-1(thu106[bar-1::2A::H1::mCherry]) X. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous bar-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9112 C. elegans mab-5(thu112[mab-5::2A::H1::mCherry]) III. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous mab-5 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9115 C. elegans Y56A3A.18(thu115[Y56A3A.18::2A::H1::mCherry]) III. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous Y56A3A.18 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9119 C. elegans sup-37(thu119[sup-37::2A::H1::mCherry]) V. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous sup-37 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9122 C. elegans ztf-14(thu120[ztf-14::2A::H1::mCherry]) X. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous ztf-14 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9126 C. elegans cbp-1(thu126[cbp-1::2A::H1::mCherry]) III. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous cbp-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9127 C. elegans nhr-67(thu127[nhr-67::LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP]) IV. Show Description
LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP was inserted at the 3' end of the endogenous nhr-67 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9129 C. elegans nhr-34(thu129[nhr-34::H1::mCherry]) IV. Show Description
H1::mCherry was inserted at the 3' end of the endogenous nhr-34 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9136 C. elegans ztf-7(thu136[ztf-7::2A::H1::mCherry]) V. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous ztf-7 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9137 C. elegans sma-3(thu137[sma-3::2A::H1::mCherry]) III. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous sma-3 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9138 C. elegans ceh-33(thu138[ceh-33::2A::H1::mCherry]) V. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous ceh-33 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9139 C. elegans F57C9.4(thu139[F57C9.4::2A::H1::mCherry]) I. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous F57C9.4 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9140 C. elegans F57A8.1(thu140[H1::GFP::2A::F57A8.1]) V. Show Description
H1::GFP::2A was inserted at the 5' end of the endogenous F57A8.1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9152 C. elegans saeg-2(thu152[saeg-2::2A::H1::mCherry]) X. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous saeg-2 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9164 C. elegans daf-3(thu164[daf-3::SL2::mCherry::H2B]) X. Show Description
SL2::mCherry::H2B was inserted at the 3' end of the endogenous daf-3 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9172 C. elegans Y53G8AR.9(thu172[pes-1::2A::NeonGreen::H2B]) III. Show Description
2A::NeonGreen::H2B was inserted at the 3' end of the endogenous pes-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9222 C. elegans hnd-1(thu22[H1::mCherry::2A::hnd-1]) X. Show Description
2A::H1::mCherry was inserted at the 5' end of the endogenous hnd-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL933 C. elegans Y53G8AR.9(thu33[Y53G8AR.9::mCherry]) III. Show Description
mCherry was inserted at the 3' end of the endogenous Y53G8AR.9 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL949 C. elegans tlp-1(thu49[tlp-1::SL2::H1::mCherry]) IV. Show Description
SL2::H1::mCherry was inserted at the 3' end of the endogenous tlp-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL99 C. elegans vab-15(thu9[vab-15::GFP]) X. Show Description
GFP was inserted at the 3' end of the endogenous vab-15 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XMN1253 C. elegans daf-15(bgg95) IV. Show Description
Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.
XR1 C. elegans abl-1(ok171) X. Show Description
1.5 kb of M79.1 locus is deleted which corresponds to the elimination of exons 8-12, including the kinase domain and 2/3 of the SH2 domains.
XT7 C. elegans cln-3.2(gk41) I; cln-3.3(gk118) cln-3.1(pk479) V. Show Description
Decreased brood size, mild life-span reduction. Made as model for Batten disease. Derived from XT2 and XT4. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
XW18042 C. elegans qxIs722 II. Show Description
qxIs722 [dpy-7p::dpy-7::SfGFP (single copy)]. qxIs722 is a single copy insertion into ttTi5605 via CRISPR/Cas9. DPY-7::SfGFP expression in cuticle over hyp7. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5.
XY1054 C. elegans cep-1(lg12501) I. Show Description
1213 bp deletion corresponding to bp 30458-31670 on cosmid F52B5. Takes out a large part of the cep-1 open reading frame.
XZ2056 C. elegans hif-1(ia4) V; yakEx126. Show Description
yakEx126 [unc-17p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from cholinergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx126 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
XZ2065 C. elegans hif-1(ia4) V; yakEx131. Show Description
yakEx131 [eft-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from a ubiquitous promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx131 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
XZ2073 C. elegans hif-1(ia4) V; yakEx137. Show Description
yakEx137 [unc-14p::hif-1(P621A)::YFP + myo-2p::mCherry]. Pick animals with red pharynx to maintain. Non-degradable form of HIF-1 tagged with YFP expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx137 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
XZ2074 C. elegans hif-1(ia4) V; yakEx136. Show Description
yakEx136 [vha-6p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from intestine-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx136 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
XZ2081 C. elegans hif-1(ia4) V; yakEx143. Show Description
yakEx143 [dpy-7p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from a hypodermal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx143 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
XZ2082 C. elegans hif-1(ia4) V; yakEx144. Show Description
yakEx144 [unc-14p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx144 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
XZ2083 C. elegans hif-1(ia4) V; yakEx145. Show Description
yakEx145 [unc-47p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from GABA-ergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx145 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
XZ2084 C. elegans hif-1(ia4) V; yakEx125. Show Description
yakEx125 [rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx125 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
XZ2085 C. elegans hif-1(ia4) V; yakEx146. Show Description
yakEx146 [vha-6p::hif-1(cDNA) + dpy-7p::hif-1(cDNA) + rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-, hypodermal-, and intestinal-specific promoters in hif-1 mutant background for tissue-specific rescuing experiments. yakEx146 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
YH461 C. elegans ifta-2(tm1724) IV. Show Description
Extended life span. daf-d.
YL585 C. elegans oef-1(vr25) IV. Show Description
vr25 is a Crispr/Cas9-induced 56 bp deletion in exon 2 of oef-1/F49E8.2 causing a frameshift and presumptive null allele. Accelerated rate of germ cell progression, precocious Z2/Z3 division in L1s, increased brood size and sperm generation, and increased germline apoptosis. Reference: McManus, CE & Reinke, V. Genetics. 2017; https://doi.org/10.1534/genetics.117.1123.
YQ95 C. elegans unc-119(ed3) III; atg-18(gk378) V; wfIs120. Show Description
wfIs120 [app-1p::atg-18::unc-54 + unc-119(+)]. Intestine-specific promoter app-1 drives atg-18 expression in the atg-18(gk378) mutant background, providing rescue in intestinal cells. Reference: Chen HD, et al. Autophagy. 2016 Nov 22:1-15.
YX9 C. elegans lin-15(n675) X; ahIs1. Show Description
ahIs1 [myo-3p::NpHR::eCFP + lin-15(+)]. Muscle specific expression of halorhodospin. In the presence of all-trans-retinol, worms are paralyzed upon light stimulation. Weak CFP expression in muscles. Reference: Faoud AD, et al. Elife. 2018 Jan 23:7:e29913. doi: 10.7554/eLife.29913. PMID: 29360037.
YY1325 C. elegans wago-4(gg620[3xflag::gfp::wago-4]) II. Show Description
3xflag::gfp inserted into endogenous wago-4 locus using CRISPR/Cas9 engineering. 3xFLAG::GFP::WAGO-4 is partially functional in this strain. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
YY1446 C. elegans znfx-1(gg634[HA::tagRFP::znfx-1]) II. Show Description
HA::tagRFP inserted into endogenous znfx-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
YY1492 C. elegans mut-16(cmp3[mut-16::gfp::flag + loxP] I; znfx-1(gg634[HA::tagRFP::znfx-1]) II; pgl-1(gg640[pgl-1::3xflag::mCardinal]) IV. Show Description
gfp::flag inserted into endogenous mut-16 locus, 3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
YY470 C. elegans dcr-1(mg375) III. Show Description
Enhanced RNAi response. Sterile at 25 C. Outcrossed from YY11; wild-type for mut-16. Superficially wild-type.
YY916 C. elegans znfx-1(gg544[3xflag::gfp::znfx-1]) II. Show Description
GFP tag inserted at the N-terminus of endogenous znfx-1 via CRISPR/Cas9. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
YY968 C. elegans znfx-1(gg544[3xflag::gfp::znfx-1]) II; pgl-1(gg547[pgl-1::3xflag::tagRFP]) IV. Show Description
3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
ZD101 C. elegans tir-1(qd4) III. Show Description
Enhanced pathogen susceptibility. Egg laying in response to food is defective. Reference: Shivers RP et al., (2009) Cell Host Microbe 6:321-30.
ZD1258 C. elegans eif-3.L(qd310) II. Show Description
C17G10.9 Increased lifespan and enhanced resistance to endoplasmic reticulum (ER) stress, independent of IRE-1-XBP-1, ATF-6, and PEK-1. Reference: Cattie DJ, et al. PLoS Genet. 2016 Sep 30;12(9):e1006326.
ZD1866 C. elegans eif-2a(qd338) I. Show Description
Y37E3.10. qd338 disrupts Ser49 phosphorylation site; suppresses daf-28(sa191) constitutive dauer entry phenotype. Reference: Kulalert W, et al. Genetics 2017. In press.