| RG3249 |
C. elegans |
nuo-3(ve749[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous mid larval arrest. Deletion of 348 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve749 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ctgaaaaataaaaaatCTATTCCTTTCCGT ; Right flanking sequence: CGGAATTGTTGGATTTGATTGGAGCGACGG. sgRNA #1: aaatCTATTCCTTTCCGTTG; sgRNA #2: CAAATCCAACAATTCCGCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3250 |
C. elegans |
Y57G11C.31(ve750[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Emb. Deletion of 4555 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead eggs (ve750 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ccagtaATGACCGAATCCACAAAATCCGGT ; Right flanking sequence: aattcatgtggaatgtttcagaatgttcac. sgRNA #1: GAATCCACAAAATCCGGTGG; sgRNA #2: aacagagaaatcatgaagtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3251 |
C. elegans |
+/nT1[umnIs49] IV; zhit-1(ve751[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous animals are sick. Deletion of 586 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sickly larvae (ve751 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: cagattaaaaaaaaaacttacTTGGCACCA ; Right flanking sequence: AGGTTTTCGTGAAGGAGCAAACATttttga. sgRNA #1: AAGTACTGTTGTACGCGATG; sgRNA #2: AGTTGATTGGCTGTTGCAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3256 |
C. elegans |
cap-1(ve756[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve756 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tggagaggattaggaagatgatgaagacca ; Right flanking sequence: tacttgagatatttagtttgaaatgttttt. sgRNA #1: tttgcttcaagttcgtctgc; sgRNA #2: atctctatccactttccgtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3257 |
C. elegans |
pfd-2(ve757[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Maternal effect embryonic lethal. Deletion of 1394 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Adult worms which lay dead eggs (ve757 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaaaatccacaacttccagATGTCGGCCG ; Right flanking sequence: TGGACAATTGCCAAAAGCTTAAatttcccc. sgRNA #1: AGTGGCGGCGGCGGTTTGAG; sgRNA #2: CTGAGAAAAGCTGAAGCTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3261 |
C. elegans |
+/nT1[umnIs49] IV; F53F4.11(ve761[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous early larval lethal. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve761 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CATGCACAGTTGGGAACAGTACAGACTGAT ; Right flanking sequence: AGGAGCAACTGACTTCACAACCTGCAGCTC. sgRNA #1: CGGTATCTTCCTTGAGAACA; sgRNA #2: TTCTTCGCAACTTCAACTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3278 |
C. elegans |
nprl-3(ve778[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Possible maternal effect: descendants of homozygous animals may be sensitive to starvation (lethal). Deletion of 2127 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate adults (ve778 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: AAATAATTTTGAATTTTCAGTGCTGTGATG ; Right flanking sequence: AGTAGCCAAGGATCTTTTATTCCGGTTTTT. sgRNA #1: TGTTTTCTCACTGGACAAAG; sgRNA #2: CGGCAACAAAATCAGGACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3282 |
C. elegans |
+/nT1[umnIs49] IV; Y61A9LA.10(ve782[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 8730 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve782 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ctTCAGGAGCTGCTCGCCGATGAGCCAAGA ; Right flanking sequence: cacggcgtgcgcgtcagtgtcacgaaacgc. sgRNA #1: GCAAAACTTCGAAAGGCTCT; sgRNA #2: aaattggttgctgacgcgca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3297 |
C. elegans |
+/nT1[umnIs49] IV; F25H9.6(ve797[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Sterile. Deletion of 1068 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve797 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aatagaagaaaaatatgatattgtCTACCC ; Right flanking sequence: AATTCGTCGGACATgttaaccgaacaagtt. sgRNA #1: AGGCAGTTCGCATCCAATGC; sgRNA #2: ATCAGTGAAAAGGCACAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3307 |
C. elegans |
+/nT1[umnIs49] IV; xpo-1(ve807[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval arrest. Deletion of 1256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve807 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TCAAACTTATAGTTTTCTTTTTTCAGGTCT ; Right flanking sequence: TGGTGTGACCTGGTTTATTTTCAATCGAAA. sgRNA #1: CGACATTCTCAAAGAATTAC; sgRNA #2: AGATGAGGATATGCGTTAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3312 |
C. elegans |
gdh-1(ve812[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve812 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TTTAATTACAAAATATTTTATTTTCAGGTA ; Right flanking sequence: GTACCCACTTCTCACTCATCTCATGGCTCT. sgRNA #1: ATGTTGAGCACTCTTTCCAG; sgRNA #2: TTATGTGAAGGTGAATCCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3341 |
C. elegans |
phf-5(ve841[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Late larval arrest. Deletion of 2354 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve841 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TGTGTGATTTGTGATTCACATGTTCGTCCA; Right flanking sequence: AGGATCGTGACGGATGCCCGAAAATTGTGA. phf-5 sgRNA #3: CAGATACGAACCAATGTACA; phf-5 sgRNA #4: AGAATGCACAATTCTCGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3342 |
C. elegans |
xpd-1(ve842[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Late larval arrest. Deletion of 11823 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve842 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. [NOTE: xpd-1 is located near the end of the region of LG III balanced by sC1, thus not known if truly balanced by sC1.] Left flanking Sequence: CCGGATAAGCTTGATAAGCTTGTCTATTGT; Right flanking sequence: AGTTATTACGCTATCATGTCATGATGCTTC. xpd-1 sgRNA #1: TCCAGAACTATTCCAGGTAG; xpd-1 sgRNA #2: GCCAGTTGACTACCATCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3344 |
C. elegans |
Y57G11C.1147(ve844[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 489 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate that give dead eggs (ve844 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ACGGACGACTCTTCCGGCAGTTGCAGACAT; Right flanking sequence: TCAACGCTGAAAAGCTGAAAAACGGTGAAG. Y57G11C.1147 sgRNA #1: GAGTATCTCCTTTGGTGACA; Y57G11C.1147 sgRNA #2: TCAGCGTTGAATGCACGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3348 |
C. elegans |
+/nT1 [umnIs49] IV; trpp-6(ve848[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval lethal. Deletion of 605 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate grotty late larval to sterile (ve848 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGAAATTATCCGTTCAACTTTGGAAAGTGA; Right flanking sequence: CCTTGCTGGTCTTAATATTAGAGTGAGTTC. trpp-6 sgRNA #1: AAAAGATCGATGTGAAGCAA; trpp-6 sgRNA #2: GCTCCGCGAAGTAAACCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3366 |
C. elegans |
+/nT1 [umnIs49] IV; F46B6.6(ve866[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 3298 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate grotty late larval to sterile (ve866 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: AAATGCTAATGTCTAAAATCCTGGTGGATA; Right flanking sequence: CGAATTGTTGAGTTTGAATTCGCCAGAATG. F46B6.6 sgRNA #1: CCAGTCGACTTCTTGAGTGA; F46B6.6 sgRNA #2: CATCTGAAGGAAAACGTGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3384 |
C. elegans |
plc-3 & srh-135(ve884[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Ste. Deletion of 6,190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve884 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: CTCACTTGGCCCATCATCGTCGTCTCGAAA; Right flanking sequence: TTTTGGAGCATTTTTTATAGTTTAAGTTTA. plc-3_srh-135 sgRNA A: GACTACAGTAACCAGCACAG; plc-3_srh-135 sgRNA B: TTTTGTGGCAAAAAACAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3390 |
C. elegans |
+/nT1 [umnIs49] IV; mpdu-1(ve890[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 658 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate adults that give dead eggs (ve890 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TAAGGTTCCGGCGAATTGAAGGAAAACGGA; Right flanking sequence: GGGAAGAGGCTTTGAATGATGTCGTTCATG. mpdu-1 sgRNA A: GATCAGGGAAAGCTGACCGG; mpdu-1 sgRNA B: GTTCTTCGAAACAATTGCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3395 |
C. elegans |
+/nT1 [umnIs49] IV; rpb-9(ve895[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Apparently semi-sterile. Deletion of 753 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate apparently semi-sterile adults (ve895 homozygotes) can be maintained as a homozygote with difficulty, Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGGAGCGTTGGATCGTGAATAATATCTCCG; Right flanking sequence: TGGCTCATCTTTCTGAAAAAATATGATAAA. rpb-9 sgRNA A: AGTGAGCTCACTCAAATCGT; rpb-9 sgRNA B: CATCGTAATTATCATACCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3408 |
C. elegans |
+/nT1 [umnIs49] IV; C37C3.18(ve908[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 801 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ arrested larvae (ve908 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGAGATCCAGTTGTGCATGTTCTTGTGCCC; Right flanking sequence: TATTTATCATTTGTAAGTACTAACAAGAGA. C37C3.18 sgRNA #1: AAATGGGCGCGAGTTTGTGT; C37C3.18 sgRNA #2: TCACGAGTCCGGTTGATATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3414 |
C. elegans |
pipp-4P(ve914[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous ste. Deletion of 7788 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve914 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: AAACCCCCTAAAATCTTCAAATTTTTCTGT; Right flanking sequence: TCAGGGTATATGCAAAAGATTCGAGCTCTC. Y71H2AM.2-sgRNA A: AGGAATGGACGTACCACCAG; Y71H2AM.2-sgRNA B: AAATTAGCGGGAAATTTGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3415 |
C. elegans |
taf-8(ve915[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 1934 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve915 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: GAATGCTTCCTCAACACAATACATTTATTA ; Right flanking sequence: ACGACTACGGCAATTATGAGGATGAAGAGA. taf-8 sgRNA A: GGAGACCGACTATTGCAGGA; taf-8 sgRNA B: TGTCGCGTATCGGAGGGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3416 |
C. elegans |
prx-2(ve916[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Maintain by picking wild-type GFP+ mKate2+. ve916 homozygotes are thin, slow-growing, lay small, slow-growing broods. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 thin slow growing hermaphrodites that can be maintained as a homozygous slow growing population (ve916 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Deletion of 1288 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCTTCCCAATAATACACTACACTGTACCCT; Right flanking sequence: TGGTCATTCTACAATAACTGAAAGCATTTT. prx-2 sgRNA A: AGGAATAGTGATAGTGGGGG; prx-2 sgRNA B: CTCTATTTCCTTCGATCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3439 |
C. elegans |
deb-1(ve939[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Maintain by picking wild-type GFP+ mKate2+. Deletion of 7456 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead embryos (ve939 homozygotes; embryonic lethal), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Left flanking Sequence: CCATCAGAATGGCCATTCTCTTCGCAGCCG; Right flanking sequence: ttgtaagatttgtacagatttttcgagctt. deb-1 sgRNA A: ACAGGAGAACGATATTGTGG; deb-1 sgRNA B: accatccataagtctcaagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3472 |
C. elegans |
rpc-1(ve972[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 3929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested early larvae (ve972 homozygotes, rare escapers are fertile adults), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GTCTTTCCATGAGCAACAATTTTACATCCT; Right flanking sequence: CGGCTTTTTTTACGGTTCctgaatacaaaa. rpc-1 crRNA A: AAAGTGTGTCCACAGATGAG; rpc-1 crRNA B: AATCTTCAGAACTGCTCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3476 |
C. elegans |
+/nT1 [umnIs49] IV; mcm-7(ve976[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval lethal. Deletion of 1803 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead translucent early larvae (ve976 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GTCTTCATATGGATAGGAACGAGGGAGCCG; Right flanking sequence: ATTCAAAGATGCGCTCGCAAGGGAATCAGC. mcm-7 sgRNA A: AAGAGAAACTTCCTCGTTGG; mcm-7 sgRNA B: GGCGTTTGAGATGGCGATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3486 |
C. elegans |
rps-15A(ve986[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Early larval arrest. Deletion of 598 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve986 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Other names: CELE_F53A3.3, uS8, rps-22. Left flanking Sequence: ATGAACGTCCTCGCCGATGCGCTCAACGCC; Right flanking sequence: CACGAGGAGGCCAGAAGAAAGCATTTGGGA. rps-22 crRNA A: ATCAACAACGCCGAGAAGCG; rps-22 crRNA B: ATCCATGATTCCGGCGGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3492 |
C. elegans |
rps-29(ve992[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Larval arrest. Deletion of 754 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve992 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caccgtcttcttgttttccgcttttttcct; Right flanking sequence: gttaacttcatgtcttcaatcaataaattg. rps-29 crRNA A: ttcgaaaaagctgtaaacgg; rps-29 crRNA B: aataacaagatttgacgagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3506 |
C. elegans |
+/nT1 [umnIs49] IV; sqv-4(ve1006[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Sterile. Deletion of 1511 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve1006 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GATCGTAGACTGATAATTTTGCATGCTCCT; Right flanking sequence: tacaatgcagaatatgcacaataaatgacg. sqv-4 crRNA A: CGTAATCAAACACTTGATGG; sqv-4 crRNA B: cgagttgattttctgtaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3507 |
C. elegans |
orai-1(ve1007[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous sterile. Deletion of 7387 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1007 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. orai-1 is near unc-45 and therefore near the outer limit of the sC1 balancer. Left flanking Sequence: ATCCTGACGTCAGAGATCTTCTGAAATCCG; Right flanking sequence: GTGTTCCGTCATGCCATTTTAATCTGTGTG. orai-1 crRNA A: CTTTCGAAGTCTCCGTTTCG; orai-1 crRNA B: GTGGCGAGACAGTGAGCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3510 |
C. elegans |
+/nT1 [umnIs49] IV; rps-27(ve1010[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 748 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larva (ve1010 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttacgacccccgttttcaccctcattacca; Right flanking sequence: GGGTGAAGAAGGTCAACGGCCAAAGGCATt. rps-27 crRNA A: atcattggctgtctcgtctc; rps-27 crRNA B: TGATCTCCCTTTGTGGCTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3511 |
C. elegans |
sars-1(ve1011[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Early larval arrest. Deletion of 1278 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larva (ve1011 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caatcattaaaaacattgccaacagttgaa; Right flanking sequence: AGgtatatataaaacttattatactaaacg. sars-1 crRNA A: aaacagtatcgaagttaagG; sars-1 crRNA B: GACCAAGAAACTGAGTGGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3515 |
C. elegans |
yars-2(ve1015[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 1304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve1015 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CATCGCCACTTCTAAACCTTCTTTTCCGTG; Right flanking sequence: tggtcggagaaaatcctcggccacccggcc. yars-2 crRNA A: CACAATTCGAGTAATTTCGG; yars-2 crRNA B: ttccacaaaactccgcgcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3517 |
C. elegans |
slc-25A26(ve1017[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Late larval arrest. Deletion of 1778 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 thin slow moving larvae (ve1017 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ATTTTAAATATGGAGTAATTTAGGATGCCA; Right flanking sequence: CGGTGGTTTTGTTTTCTTCGGTGCCTATGA. slc-25A26 crRNA A: ACCACCGATCCTTCTTCTGA; slc-25A26 crRNA B: CGTGTAATGTGGATTTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3520 |
C. elegans |
+/nT1 [umnIs49] IV; F32D8.5(ve1020[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Sterile. Deletion of 589 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1020 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGACAACTTAATCTTGAGTGAAATCTTCCT; Right flanking sequence: TACTTCATTTTCTTGCAAAACGATTTCCCA. F32D8.5 crRNA A: ATTAAAAGCAGGTTCAGCGC; F32D8.5 crRNA B: GTAGCGGAGTGAAAGATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3536 |
C. elegans |
nuaf-3(ve1036[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Sterile. Deletion of 1840 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1036 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GATTTCTGAGCAGTTCATCAAAAAATACGA; Right flanking sequence: CGGAAAAGCTGCAGAATTGTCATAGCCTGA. nuaf-3 crRNA A: TAGGAGGAGGAGATGCGAAT; nuaf-3 crRNA B: GATGCCAGTGTACAGAGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5044 |
C. elegans |
gex-3(gk5235[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 [umnIs49] IV; +/ nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5235 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4152 and CGC63. gk5235 is a 2546 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCGACGTTCGAATATGTACAAGAAAAGTC; Right flanking sequence: TGCTTCATCTGGTCATATGGTTTGGAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5045 |
C. elegans |
+/nT1 [umnIs49] IV; vha-13(gk5758[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5758 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4759 and CGC63. gk5758 is a 2243 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCCAGGAAAAGATGGCCGCAGAATCTTCG; Right flanking sequence: CGCTAGATTCTGTTCAGTTTTGCTGAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5046 |
C. elegans |
iars-1(gk5827[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5827 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4759 and CGC63. gk5827 is a 3755 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCGTTCCCGACAACATCAATTTTGCCAGAG; Right flanking sequence: GGCGGTCCATCCAACAGTTGACGTGACGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5047 |
C. elegans |
+/ nT1 [umnIs49] IV; vars-1(gk5828[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5828 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4760 and CGC63. gk5828 is a 3391 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGTTTGACAAAAAAATATTTTTTAATCTTC; Right flanking sequence: AGGAACAGTTTCAAGCAAGAATTGCATCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5060 |
C. elegans |
ZK622.4(hd7010[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mIn1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (hd7010 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Derived from parental strains VH7029 and CGC53. hd7010 is a 180 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking sequence: ATGGATCCATGTTTCATAAAGGATGTTTTA; Right flanking sequence: ATCAAATCTTCTTTTCTCGCCAAAAACGAA. sgRNA #1: AATGTTGGATTTGCGGAACC; sgRNA #2: CGATGTGGAATTGGATCATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5100 |
C. elegans |
+/nT1 [umnIs49] IV; arp-11(gk5656[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5656 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4586 and CGC63. gk5656 is a 2105 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCAGCAGCTAATTTTCCATTTTTCCACTC. Right flanking sequence: TCAGCGACTCCAACGTTGATTGAGCAGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5101 |
C. elegans |
cpt-2(gk5869[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 (gk5869 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4801 and CGC63. gk5869 is a 3129 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCAATTTTCAGATGCTTCGTTCCTCAA. Right flanking sequence: CGTGGTCACCTTCTCGATCCGAAATAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5103 |
C. elegans |
ampd-1(gk5139[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mIn1 [dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (L1-L2 stage lethal), and non-GFP mKate2+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4065 and CGC53. gk5139 is a 5156 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAGTCTGATGAAGATTCTGAGCCACCA. Right flanking sequence: TACCAATGTTCCAGATATTCGTGTCAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5108 |
C. elegans |
Y71H2AM.20(gk5290[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Apparent homozygous lethal or sterile deletion balanced over labeled sC1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5290 homozygotes (Let), and Dpy mKate2+ sC1 homozygotes. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4205 and CGC51. gk5290 is a deletion of 2953 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGATTCGACGACAGATGACGAATGGACGG. Right flanking sequence: CACGGATTCAGGTCGAACACATTTTTAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5109 |
C. elegans |
sbds-1(gk5584[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Apparent homozygous lethal or sterile deletion balanced over labeled sC1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5584 homozygotes (Let), and Dpy mKate2+ sC1 homozygotes. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4513 and CGC51. gk5584 is a deletion of 1745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTGAGATCCAAAAAGAATTCTCGGGTGTGT. Right flanking sequence: ATTGGTCAGAACTTTCTGATTTGTCGGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7154 |
C. elegans |
hsp-60 (hd7146 [loxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7146 homozygotes), Dpy non-GFP mKate2+ sC1 homozygotes. Derived from parental strains VH7146 and CGC51. hd7146 is a 4918 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTTATTCCTGTATTTTTCAGTCATTACCT; Right flanking sequence: GCAATTTTTTGTATGATTTTTCATCAATTT. sgRNA #1: TGCATTATCGTCTGGGAAGC; sgRNA #2: AGAAAACCGATAAAATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7156 |
C. elegans |
+/nT1 [umnls49] IV; ncx-2 (hd7147 [loxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + loxP])/nT1 V Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain.. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7147 and CGC63. hd7147 is a 7691 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCTTCAATTCTTCAATTTTTCCAATTCTTC; Right flanking sequence: TCTTTTCTGGTCGACAAAGGTGCCTAAATC. sgRNA #1: ATAAAGTGAAGATTGGTGGG; sgRNA #2: AACAGTGTTTTGGGGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7173 |
C. elegans |
+/nT1 [umnls49] IV; mrps-2 (hd7170 [loxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + loxP])/nT1 V Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7170 and CGC63. hd7170 is a 966 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CAGAAAGAGCCTTCTCGACACGATTTTCCG; Right flanking sequence: TTCGAAAGTGGCAATCAGGAACTCTAACGA. sgRNA #1: AATGGTTACCTGCTGCGACG; sgRNA #2: GGTTGGGCAATACTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7186 |
C. elegans |
+/nT1 [umnls49] IV; algn-5 (hd7175[loxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7175 and CGC63. hd7175 is a 1325 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCCAAAAAATCAATATCTTCACCATTTTCA; Right flanking sequence: TGGAGCTACAAAATTCGCCGATTTTGAAAA. sgRNA #1: GACTTTCCTACGCAACACCA; sgRNA #2: ATTCTCTTCGCAGATGCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|